» Site Navigation
0 members and 1,944 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,107
Threads: 249,255
Posts: 2,572,992
Top Poster: JLC (31,651)
|
-
New albino- help with genetics?
I am picking up a new albino male. His father is a "Candino" and his mother is a pinstripe albino. What does that mean for the genetics of mine? Would he be het for candino and pinstripe?
Malcolm, '12 normal | Alice, '14 Pied | Sebastían, '15 Mojave | Damián, '16 Albino
View My iHerp Page
-
-
hes either a candino or a pin candino as far as I know. No het will be involved
-
-
Re: New albino- help with genetics?
I found a calculator on MorphMarket that says he would just be albino, no hets. This stuff confuses me. It's an academic question, really, as I've no intention of breeding him.
Malcolm, '12 normal | Alice, '14 Pied | Sebastían, '15 Mojave | Damián, '16 Albino
View My iHerp Page
-
-
All of the offspring from that pairing would be candino or albino with 50% of them being pinstripe. Candy and Albino are on the same allele which in simple terms means you can only have candy+albino or albino+albino. A single animal cannot carry albino+albino+candy. As predator said, this would be a full expression animal het for nothing.
Last edited by JodanOrNoDan; 03-17-2017 at 01:50 PM.
-
The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:
Dezoruba (03-18-2017),dr del (03-17-2017)
-
Pinstripe is a codominant gene; he either has it or he doesn't, there is no het. And being born from a candino doesn't necessarily affect his genetics either. Candy is a recessive trait (like albinism), meaning you need two genes present to visually express it, but it's also compatible with albino. Meaning if you breed an albino and a candy together instead of getting all normal looking double hets you will get all candinos-- animals that have one copy of the albino gene and one copy of the candy gene on the same allele and express a mix of both traits.
Since he was born from an albino pin female bred to a candino male, there are no uncertainties with babies being hets. The only possible results from that pairing would be albinos, albino pins, candinos, and candino pins, which are all relatively easy to tell apart after the first couple of sheds, so safe to say your male isn't keeping any secrets.
Hope this helps
Last edited by Trisnake; 03-17-2017 at 01:51 PM.
-
-
Unless your animal looks Pinstripe, he is not carrying the Pinstripe gene. Pinstripe is an incomplete dominant gene and is either there or its not.
Candy and Albino are compatible recessive genes - the combination of the two gives you a Candino. From the pairing you shared, the breeder had the following offspring as possibilities:
- 25% Candino
- 25% Albino
- 25% Pinstripe Candino
- 25% Pinstripe Albino
It would take a keen eye to differentiate between the Candino offspring and the Albino offspring, but if the breeder feels confident is saying he's an Albino, that's what he likely is. He wouldn't be het for anything else since there's nothing to be het for in this pairing.
-
The Following User Says Thank You to Eric Alan For This Useful Post:
-
Re: New albino- help with genetics?
 Originally Posted by Eric Alan
It would take a keen eye to differentiate between the Candino offspring and the Albino offspring, but if the breeder feels confident is saying he's an Albino, that's what he likely is.
Nice breakdown Eric. Just a small clarification -- your eye does not have to be keen after they have gone through a few sheds. Once a Candino has coloured up there is no doubt about its identity. Likewise, when the all the animals in the clutch are the same age and the Candinos have coloured up it is pretty safe to say that anything that has not coloured up is firmly Albino
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
Re: New albino- help with genetics?
 Originally Posted by asplundii
Nice breakdown Eric. Just a small clarification -- your eye does not have to be keen after they have gone through a few sheds. Once a Candino has coloured up there is no doubt about its identity. Likewise, when the all the animals in the clutch are the same age and the Candinos have coloured up it is pretty safe to say that anything that has not coloured up is firmly Albino
Absolutely true. As they grow, it is MUCH easier to see the difference if you know what you are looking for. Not everyone does though, which is why I said what I did. Thanks!
-
The Following 2 Users Say Thank You to Eric Alan For This Useful Post:
asplundii (03-20-2017),PitOnTheProwl (03-17-2017)
-
Re: New albino- help with genetics?
 Originally Posted by Eric Alan
Absolutely true. As they grow, it is MUCH easier to see the difference if you know what you are looking for. Not everyone does though, which is why I said what I did. Thanks!
I personally don't see the difference between albino and candino at all. I looked at pics online and they basically look the same to me.
Malcolm, '12 normal | Alice, '14 Pied | Sebastían, '15 Mojave | Damián, '16 Albino
View My iHerp Page
-
-
Re: New albino- help with genetics?
 Originally Posted by Hypancistrus
I personally don't see the difference between albino and candino at all. I looked at pics online and they basically look the same to me.
See the difference? 
As has been said they start off looking the same as an albino. Once they start to colour up there is definitely a noticeable difference.
Sent from my iPhone using Tapatalk
-
The Following User Says Thank You to kxr For This Useful Post:
JodanOrNoDan (03-18-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|