Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,869

1 members and 1,868 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,083
Threads: 249,223
Posts: 2,572,823
Top Poster: JLC (31,651)
Welcome to our newest member, Morphology
Results 1 to 10 of 11

Threaded View

  1. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: New albino- help with genetics?

    Quote Originally Posted by Eric Alan View Post
    It would take a keen eye to differentiate between the Candino offspring and the Albino offspring, but if the breeder feels confident is saying he's an Albino, that's what he likely is.
    Nice breakdown Eric. Just a small clarification -- your eye does not have to be keen after they have gone through a few sheds. Once a Candino has coloured up there is no doubt about its identity. Likewise, when the all the animals in the clutch are the same age and the Candinos have coloured up it is pretty safe to say that anything that has not coloured up is firmly Albino
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Eric Alan (03-17-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1