Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 739

1 members and 738 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,139
Posts: 2,572,328
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Page 1 of 2 12 LastLast
Results 1 to 10 of 11
  1. #1
    BPnet Veteran Hypancistrus's Avatar
    Join Date
    09-24-2009
    Location
    Baltimore, MD
    Posts
    405
    Thanks
    104
    Thanked 154 Times in 86 Posts

    New albino- help with genetics?

    I am picking up a new albino male. His father is a "Candino" and his mother is a pinstripe albino. What does that mean for the genetics of mine? Would he be het for candino and pinstripe?
    Malcolm, '12 normal | Alice, '14 Pied | Sebastían, '15 Mojave | Damián, '16 Albino

    View My iHerp Page

  2. #2
    Registered User predatorkeeper87's Avatar
    Join Date
    12-22-2016
    Location
    The sticks, PA
    Posts
    351
    Thanks
    82
    Thanked 241 Times in 142 Posts
    hes either a candino or a pin candino as far as I know. No het will be involved

  3. #3
    BPnet Veteran Hypancistrus's Avatar
    Join Date
    09-24-2009
    Location
    Baltimore, MD
    Posts
    405
    Thanks
    104
    Thanked 154 Times in 86 Posts

    Re: New albino- help with genetics?

    I found a calculator on MorphMarket that says he would just be albino, no hets. This stuff confuses me. It's an academic question, really, as I've no intention of breeding him.
    Malcolm, '12 normal | Alice, '14 Pied | Sebastían, '15 Mojave | Damián, '16 Albino

    View My iHerp Page

  4. #4
    BPnet Senior Member JodanOrNoDan's Avatar
    Join Date
    09-23-2015
    Location
    Everglades
    Posts
    3,042
    Thanks
    2,017
    Thanked 2,853 Times in 1,575 Posts
    Images: 77
    All of the offspring from that pairing would be candino or albino with 50% of them being pinstripe. Candy and Albino are on the same allele which in simple terms means you can only have candy+albino or albino+albino. A single animal cannot carry albino+albino+candy. As predator said, this would be a full expression animal het for nothing.
    Last edited by JodanOrNoDan; 03-17-2017 at 01:50 PM.

  5. The Following 2 Users Say Thank You to JodanOrNoDan For This Useful Post:

    Dezoruba (03-18-2017),dr del (03-17-2017)

  6. #5
    BPnet Veteran Trisnake's Avatar
    Join Date
    08-20-2016
    Location
    North of Houston, TX
    Posts
    551
    Thanks
    378
    Thanked 290 Times in 209 Posts
    Images: 1
    Pinstripe is a codominant gene; he either has it or he doesn't, there is no het. And being born from a candino doesn't necessarily affect his genetics either. Candy is a recessive trait (like albinism), meaning you need two genes present to visually express it, but it's also compatible with albino. Meaning if you breed an albino and a candy together instead of getting all normal looking double hets you will get all candinos-- animals that have one copy of the albino gene and one copy of the candy gene on the same allele and express a mix of both traits.

    Since he was born from an albino pin female bred to a candino male, there are no uncertainties with babies being hets. The only possible results from that pairing would be albinos, albino pins, candinos, and candino pins, which are all relatively easy to tell apart after the first couple of sheds, so safe to say your male isn't keeping any secrets.

    Hope this helps
    Last edited by Trisnake; 03-17-2017 at 01:51 PM.

  7. #6
    BPnet Lifer Eric Alan's Avatar
    Join Date
    03-01-2013
    Location
    Gilbert, AZ
    Posts
    4,511
    Thanks
    2,927
    Thanked 3,889 Times in 1,948 Posts
    Images: 1
    Unless your animal looks Pinstripe, he is not carrying the Pinstripe gene. Pinstripe is an incomplete dominant gene and is either there or its not.

    Candy and Albino are compatible recessive genes - the combination of the two gives you a Candino. From the pairing you shared, the breeder had the following offspring as possibilities:
    • 25% Candino
    • 25% Albino
    • 25% Pinstripe Candino
    • 25% Pinstripe Albino

    It would take a keen eye to differentiate between the Candino offspring and the Albino offspring, but if the breeder feels confident is saying he's an Albino, that's what he likely is. He wouldn't be het for anything else since there's nothing to be het for in this pairing.
    Find me on Facebook: E.B. Ball Pythons and Instagram: @EBBallPythons

  8. The Following User Says Thank You to Eric Alan For This Useful Post:

    asplundii (03-17-2017)

  9. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: New albino- help with genetics?

    Quote Originally Posted by Eric Alan View Post
    It would take a keen eye to differentiate between the Candino offspring and the Albino offspring, but if the breeder feels confident is saying he's an Albino, that's what he likely is.
    Nice breakdown Eric. Just a small clarification -- your eye does not have to be keen after they have gone through a few sheds. Once a Candino has coloured up there is no doubt about its identity. Likewise, when the all the animals in the clutch are the same age and the Candinos have coloured up it is pretty safe to say that anything that has not coloured up is firmly Albino
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. The Following User Says Thank You to asplundii For This Useful Post:

    Eric Alan (03-17-2017)

  11. #8
    BPnet Lifer Eric Alan's Avatar
    Join Date
    03-01-2013
    Location
    Gilbert, AZ
    Posts
    4,511
    Thanks
    2,927
    Thanked 3,889 Times in 1,948 Posts
    Images: 1

    Re: New albino- help with genetics?

    Quote Originally Posted by asplundii View Post
    Nice breakdown Eric. Just a small clarification -- your eye does not have to be keen after they have gone through a few sheds. Once a Candino has coloured up there is no doubt about its identity. Likewise, when the all the animals in the clutch are the same age and the Candinos have coloured up it is pretty safe to say that anything that has not coloured up is firmly Albino
    Absolutely true. As they grow, it is MUCH easier to see the difference if you know what you are looking for. Not everyone does though, which is why I said what I did. Thanks!
    Find me on Facebook: E.B. Ball Pythons and Instagram: @EBBallPythons

  12. The Following 2 Users Say Thank You to Eric Alan For This Useful Post:

    asplundii (03-20-2017),PitOnTheProwl (03-17-2017)

  13. #9
    BPnet Veteran Hypancistrus's Avatar
    Join Date
    09-24-2009
    Location
    Baltimore, MD
    Posts
    405
    Thanks
    104
    Thanked 154 Times in 86 Posts

    Re: New albino- help with genetics?

    Quote Originally Posted by Eric Alan View Post
    Absolutely true. As they grow, it is MUCH easier to see the difference if you know what you are looking for. Not everyone does though, which is why I said what I did. Thanks!
    I personally don't see the difference between albino and candino at all. I looked at pics online and they basically look the same to me.
    Malcolm, '12 normal | Alice, '14 Pied | Sebastían, '15 Mojave | Damián, '16 Albino

    View My iHerp Page

  14. #10
    BPnet Veteran kxr's Avatar
    Join Date
    12-01-2014
    Location
    Ontario, Canada
    Posts
    740
    Thanks
    414
    Thanked 462 Times in 329 Posts

    Re: New albino- help with genetics?

    Quote Originally Posted by Hypancistrus View Post
    I personally don't see the difference between albino and candino at all. I looked at pics online and they basically look the same to me.
    See the difference?

    As has been said they start off looking the same as an albino. Once they start to colour up there is definitely a noticeable difference.


    Sent from my iPhone using Tapatalk

  15. The Following User Says Thank You to kxr For This Useful Post:

    JodanOrNoDan (03-18-2017)

Page 1 of 2 12 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1