Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,834

0 members and 1,834 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,049
Threads: 249,209
Posts: 2,572,705
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Results 1 to 10 of 12

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I have yet to keep them, breeders for them are few and far between. But I have always been interested and studied up on them quite a bit. Found one a few years back while rafting in ID, awesome creatures
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    zina10 (03-03-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1