Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 678

1 members and 677 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

» Stats

Members: 75,945
Threads: 249,139
Posts: 2,572,328
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 12

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Learning more about genetics and morphing

    Quote Originally Posted by paulh View Post
    The principles of genetics are the same for corn, fruit flies, mice and snakes.
    ^^^
    THIS!!

    Remember this. The longer you are in this hobby the more likely you are to hear people say "ball python genetics" or "hognose genetics" or "retic genetics" as if the genetics in these animals operates in some completely unfathomable way. Genetics is genetics is genetics. If you are using textbooks and the like to get a grasp of genetics from well studied model organisms like mice and fruit flies and such then you will be well equipped to handle the basics of your snakes
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Charles8088 (02-24-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1