» Site Navigation
0 members and 885 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,945
Threads: 249,138
Posts: 2,572,326
Top Poster: JLC (31,651)
|
-
Learning more about genetics and morphing
Can someone recommend a good link, site, resource, where I can read a little more about the genetics of ball python breeding? Can't seem to find anything that explains or teaches really well.
0.1 Mexican Black Kingsnake (Tynee)
0.1 BEL Ball (Luna)
0.1 Sunglow Boa (Pippi Longsnake)
0.1 Woma Python (Uma)
WANT LIST
- Mangrove Snake
- Russian Rat Snake
- Eastern Indigo
- Black Milk Snake
- False Water Cobra
- Rhino Rat Snake
- Thai Bamboo Rat Snake
- Western Hognose
- Kenyan Sand Boa
-
-
-
The Following 2 Users Say Thank You to predatorkeeper87 For This Useful Post:
Albert Clark (02-23-2017),Charles8088 (02-23-2017)
-
Learning more about genetics and morphing

Lots of photos too!
Last edited by Reinz; 02-23-2017 at 12:57 PM.
The one thing I found that you can count on about Balls is that they are consistent about their inconsistentcy.
1.2 Coastal Carpet Pythons
Mack The Knife, 2013
Lizzy, 2010
Etta, 2013
1.1 Jungle Carpet Pythons
Esmarelda , 2014
Sundance, 2012
2.0 Common BI Boas, Punch, 2005; Butch, age?
0.1 Normal Ball Python, Elvira, 2001
0.1 Olive (Aussie) Python, Olivia, 2017
Please excuse the spelling in my posts. Auto-Correct is my worst enema.
-
The Following User Says Thank You to Reinz For This Useful Post:
-
Both exactly what I need. Thank you.
0.1 Mexican Black Kingsnake (Tynee)
0.1 BEL Ball (Luna)
0.1 Sunglow Boa (Pippi Longsnake)
0.1 Woma Python (Uma)
WANT LIST
- Mangrove Snake
- Russian Rat Snake
- Eastern Indigo
- Black Milk Snake
- False Water Cobra
- Rhino Rat Snake
- Thai Bamboo Rat Snake
- Western Hognose
- Kenyan Sand Boa
-
-
I still refer to that link when I confuse the hell out of myself with morph crosses haha
-
-
BPnet Veteran
Re: Learning more about genetics and morphing
 Originally Posted by Reinz
Lots of photos too!
You like them pictures books there do ya reinz? Haha had to sorry...
Sent from my iPhone using Tapatalk
1.0 pastel 100% het piebald
0.1 pastel enchi 100% het clown
-
-
u can also play around with a morph/genetics calculator and see what makes what: http://www.morphmarket.com/c/reptile...tic-calculator
RIP Mamba
----------------
Wicked ones now on IG & FB!6292
-
-
In many ways, I like the Basic Genetics sticky on this forum. But the pictures are all wrong. See post 94 at https://ball-pythons.net/forums/show...enetics/page10
Cost of McCurley's "The Complete Ball Python" is $48.75 at Amazon. That is more than I am willing to spend. Particularly after I looked at McCurley's genetics web site.
The principles of genetics are the same for corn, fruit flies, mice and snakes. A used copy of Schaum's Outline of Genetics, Fifth Edition (Schaum's Outlines), by Susan Elrod and William Stansfield, would only cost a few dollars. (I have the third edition; it is well done.)
The USA National Institute of Health's "Genetics Home Reference" is free for the download.
https://ghr.nlm.nih.gov/primer
"Genetics for Herpers" by Charles Pritzel is good.
https://www.amazon.com/s/ref=nb_sb_n...cs+for+herpers
I wrote a genetics guide. http://www.redtailboas.com/f115/no-f...s-guide-53782/
It is on a boa constrictor web site, but the principles are the same for ball pythons. I get on here pretty regularly so can expand on points that are unclear.
"Survey of Genetics" by Wilmer Miller. Free for the download. It is divided into 4 pdf files, but there are free tools that can stitch them together if desired. See the Contents page at www.ringneckdove.com For what it's worth, Miller taught me most of what I know about genetics.
Here are some good videos. http://learn.genetics.utah.edu/content/basics/
-
The Following User Says Thank You to paulh For This Useful Post:
-
All great information, thank you. Going to check out those books and sites.
0.1 Mexican Black Kingsnake (Tynee)
0.1 BEL Ball (Luna)
0.1 Sunglow Boa (Pippi Longsnake)
0.1 Woma Python (Uma)
WANT LIST
- Mangrove Snake
- Russian Rat Snake
- Eastern Indigo
- Black Milk Snake
- False Water Cobra
- Rhino Rat Snake
- Thai Bamboo Rat Snake
- Western Hognose
- Kenyan Sand Boa
-
-
Re: Learning more about genetics and morphing
 Originally Posted by paulh
The principles of genetics are the same for corn, fruit flies, mice and snakes.
^^^
THIS!!
Remember this. The longer you are in this hobby the more likely you are to hear people say "ball python genetics" or "hognose genetics" or "retic genetics" as if the genetics in these animals operates in some completely unfathomable way. Genetics is genetics is genetics. If you are using textbooks and the like to get a grasp of genetics from well studied model organisms like mice and fruit flies and such then you will be well equipped to handle the basics of your snakes
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|