Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,755

2 members and 1,753 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,102
Threads: 249,251
Posts: 2,572,965
Top Poster: JLC (31,651)
Welcome to our newest member, kwabenajohnson
Results 1 to 7 of 7

Hybrid View

  1. #1
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: chimera and paradox

    Quote Originally Posted by DennisM View Post
    Well, since we know a great many mechanisms that generate "paradox" type phenotype, it would seem you are in agreement with my original post that chimera and paradox should not be used interchangeably. That being the case apparently, then you can not say that you know if a given animal is a chimera.
    Yes, I agree that chimera and "paradox" should not be used interchangeably.

    However, I disagree with your final assertion. With the proper method of interrogation, it is indeed possible to tell if a given animal is a chimera.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #2
    BPnet Veteran DennisM's Avatar
    Join Date
    07-19-2014
    Posts
    907
    Thanks
    104
    Thanked 571 Times in 379 Posts
    Images: 24

    Re: chimera and paradox

    Quote Originally Posted by asplundii View Post
    Yes, I agree that chimera and "paradox" should not be used interchangeably.

    However, I disagree with your final assertion. With the proper method of interrogation, it is indeed possible to tell if a given animal is a chimera.
    Ok, I won't request what that interrogation would be as I could probably pass genetics 101, but not 102.

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1