» Site Navigation
0 members and 898 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,107
Posts: 2,572,120
Top Poster: JLC (31,651)
|
-
chimera and paradox
I’ve noticed in the last few months here on BP.net that terms chimera and paradox have become synonymous. I’m thinking this is not true. Opinions?
-
-
Chimera is one scenerio that can cause Paradox
-
The Following 2 Users Say Thank You to OhhWatALoser For This Useful Post:
Dezoruba (02-10-2017),Slither Seeker (02-10-2017)
-
Re: chimera and paradox
 Originally Posted by OhhWatALoser
Chimera is one scenerio that can cause Paradox
agreed, but i'm thinking not all paradox are chimera. and probably we can never really know.
-
-
Re: chimera and paradox
 Originally Posted by DennisM
agreed, but i'm thinking not all paradox are chimera.
OWAL was not saying that all "paradox" were chimera, just that chimera are one of the ways by which you can generate a "paradox"-type animal.
 Originally Posted by DennisM
and probably we can never really know.
We can certainly know. Genetics is genetics is genetics. There is nothing about the genetics of ball pythons (or any other herp) that is any different than the genetics of any other organism on the planet. We know of a great many mechanisms in other species that generate "paradox"-type phenotypes. It is an absolute certainty that some (perhaps even all) of these mechanisms are at play in our animals.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: chimera and paradox
 Originally Posted by asplundii
We can certainly know. Genetics is genetics is genetics. There is nothing about the genetics of ball pythons (or any other herp) that is any different than the genetics of any other organism on the planet. We know of a great many mechanisms in other species that generate "paradox"-type phenotypes. It is an absolute certainty that some (perhaps even all) of these mechanisms are at play in our animals.
Well, since we know a great many mechanisms that generate "paradox" type phenotype, it would seem you are in agreement with my original post that chimera and paradox should not be used interchangeably. That being the case apparently, then you can not say that you know if a given animal is a chimera.
-
-
Re: chimera and paradox
 Originally Posted by DennisM
Well, since we know a great many mechanisms that generate "paradox" type phenotype, it would seem you are in agreement with my original post that chimera and paradox should not be used interchangeably. That being the case apparently, then you can not say that you know if a given animal is a chimera.
Yes, I agree that chimera and "paradox" should not be used interchangeably.
However, I disagree with your final assertion. With the proper method of interrogation, it is indeed possible to tell if a given animal is a chimera.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Re: chimera and paradox
 Originally Posted by asplundii
Yes, I agree that chimera and "paradox" should not be used interchangeably.
However, I disagree with your final assertion. With the proper method of interrogation, it is indeed possible to tell if a given animal is a chimera.
Ok, I won't request what that interrogation would be as I could probably pass genetics 101, but not 102.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|