Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,159

0 members and 1,159 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,067
Threads: 249,217
Posts: 2,572,782
Top Poster: JLC (31,651)
Welcome to our newest member, Inky Clouds
Results 1 to 10 of 14

Thread: Define Paradox

Threaded View

  1. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    As you note in your original post, "paradox" is just another term in the hobby that holds zero legitimate value other than as a descriptor.

    I have always used it to describe an animal displaying areas of pigmentation/pattern that are contrary to the accepted base morph of the animal. So, in terms of pigmentation, an Albino animal with a patch of normal melanin pigmented skin would be "paradox" and, flipping it around, a normal coloured animal with an Albino-like amelanistic patch would also be "paradox". A pattern-type "paradox" would be a Spider with a patch of WT patterning on it or, flip side, a WT with a patch of Spider pattern

    As far as using "paradox" to describe a ringer... Nope. Without going too deep in the weeds, how ringers occur is not a total enigma -- it is most probably a single mechanism at play
    Last edited by PitOnTheProwl; 01-23-2017 at 11:05 AM. Reason: language
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1