» Site Navigation
1 members and 601 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,909
Threads: 249,108
Posts: 2,572,136
Top Poster: JLC (31,651)
|
-
Define Paradox
I'm curious since I had a little FB discussion last night. What do you consider a Paradox? Personally I've only herd/seen it used to describe chimera type animals, the ones that show multiple genes in the same snake, like the half albino half normals and the plethora of other examples. Apperently other use it to also describe animals like ringers, oddities from incubator malfunction, and pretty much anything considered odd.
Now Paradox it the sense we use it is a completely made up term, like super so there isn't really a right or wrong answer, but I was curious how you use it.
-
-
Paradox and Dinker don't seem to hold the weight that they use to.
Both terms seem to get thrown around a lot more than they should, they are now the equivalent of a participation ribbon. LoL
-
The Following 2 Users Say Thank You to PitOnTheProwl For This Useful Post:
Dezoruba (01-21-2017),PokeyTheNinja (01-21-2017)
-
Re: Define Paradox
Ok I define a paradox as a snake that let's say is an albino but has parts of normal color and pattern on some parts have you heard of the atomic morph? It's one I've been wanting since I heard of it as its like a genetic paradox sorta because say you have a banana cinnamon atomic you would get an animal that's part banana and part cinnamon colors and patterns they look insane and a trade mark appearantly is half the head color/pattern will be 1 morph and the other half will be the other morph
retro gaming pokemon for gbc/gba p.s. I've never played go nor shall i !!!!!
-
-
Re: Define Paradox
This is only the base morph atomic and the atomic queenbee both look amazing to me and theirs dozens more morphs I believe but either way I'm going to get an atomic one day<3 and cross it into everything I have lol let me know what you all think of this this morph atomic as its the closest to a paradox we have to genetic
http://www.worldofballpythons.com/morphs/atomic/
http://www.worldofballpythons.com/mo...mic-queen-bee/
retro gaming pokemon for gbc/gba p.s. I've never played go nor shall i !!!!!
-
-
Re: Define Paradox
 Originally Posted by PitOnTheProwl
Paradox and Dinker don't seem to hold the weight that they use to.
Both terms seem to get thrown around a lot more than they should, they are now the equivalent of a participation ribbon. LoL
Lol, I've never heard Paradox used that way, but I know what you mean about dinker. At least my induction to the word was it was an opinion whether you thought the animal had potential for something. But then when you see animals advertised as a dinker, it like hey... I'll be the judge of my own opinion. Just like when people advertise things as A+ or high quality, again... I'll be the judge of that if I'm buying it.
 Originally Posted by Ballpythonguy92
Ok I define a paradox as a snake that let's say is an albino but has parts of normal color and pattern on some parts have you heard of the atomic morph? It's one I've been wanting since I heard of it as its like a genetic paradox sorta because say you have a banana cinnamon atomic you would get an animal that's part banana and part cinnamon colors and patterns they look insane and a trade mark appearantly is half the head color/pattern will be 1 morph and the other half will be the other morph
retro gaming pokemon for gbc/gba p.s. I've never played go nor shall i !!!!!
Yes I have seen the atomic stuff and I think it's super exciting for the hobby. I'm actually surprised it's not hyped up more. Some combos do look chimera like, other just really cool. But yea it's the closest thing to genetic Paradox I've seen
Last edited by OhhWatALoser; 01-21-2017 at 10:03 AM.
-
The Following 2 Users Say Thank You to OhhWatALoser For This Useful Post:
-
Re: Define Paradox
Yea i can't wait till it's more out their and more people are working with the atomic as I can only imagine what Kevin from nerd what do lol him and his 7+ gene snakes expressing all genes omg I can't even fathem what he would do with the atomic lol
retro gaming pokemon for gbc/gba p.s. I've never played go nor shall i !!!!!
-
-
I define those terms as follows:
Paradox: is an abnormal unexpected coloration of the snake based on known genetics. It is usually just a blotch or two or some unexpected colors showing up on usually small portions of the snake. It is not genetic and can't be passed along to the offspring, it's just a random oddity. Here's an example, this should be just a Coral Glow but the black spots can't be explained with normal genetics so we call them a 'Paradox', not genetic so we can't give them a name and can't be passed to offspring. If it were genetic we would give a name to this new morph.

Dinker: is a normal ball python that we think may have potential to have a new color or pattern that is genetic. It may or may not be the next new morph. Most dinkers are just normals with interesting patterns or colors that can not be passed along to the offspring, but we hope they can (everyone hopes their normal is a dinker LOL).
Chimera: is a genetic anomaly, i.e. more than the usual number of genes in one genetic locality. We know we need two genes at one location for a recessive or a super, a Chimera has three or more at that location and it's a one time oddity that can't be reproduced.
Last edited by cchardwick; 01-21-2017 at 11:59 AM.
-
The Following User Says Thank You to cchardwick For This Useful Post:
-
Re: Define Paradox
 Originally Posted by cchardwick
Chimera: is a genetic anomaly, i.e. more than the usual number of genes in one genetic locality. We know we need two genes at one location for a recessive or a super, a Chimera has three or more at that location and it's a one time oddity that can't be reproduced.
While Paradox and Dinker have completly subjective definition in the hobby, chimera is pretty established in biology already and that's not how it works. Chimeras have 2 (or more in theory) sets of DNA. Essentially siblings in one snake.
-
The Following 2 Users Say Thank You to OhhWatALoser For This Useful Post:
asplundii (01-23-2017),BPGator (01-23-2017)
-
Re: Define Paradox
 Originally Posted by Ballpythonguy92
Any photos of the single gene visible atomic? WOB only has combos. I have never even seen atomic for sale. How long has this gene been around?
Sent from my SM-G935V using Tapatalk
0.1 Woma Pinstripe "Gemma"
0.1 Ultramel "Lyla"
0.1 Bamboo Woma "Tara"
0.1 Rio(Super Arroyo) "Wendy"
1.0 Clown "Happy"
1.0 Pastel Butter Ghost "Unser"
1.0 KillerBee Yellow Belly "Half-Sack"
-
The Following User Says Thank You to OTorresUSMC For This Useful Post:
-
As you note in your original post, "paradox" is just another term in the hobby that holds zero legitimate value other than as a descriptor.
I have always used it to describe an animal displaying areas of pigmentation/pattern that are contrary to the accepted base morph of the animal. So, in terms of pigmentation, an Albino animal with a patch of normal melanin pigmented skin would be "paradox" and, flipping it around, a normal coloured animal with an Albino-like amelanistic patch would also be "paradox". A pattern-type "paradox" would be a Spider with a patch of WT patterning on it or, flip side, a WT with a patch of Spider pattern
As far as using "paradox" to describe a ringer... Nope. Without going too deep in the weeds, how ringers occur is not a total enigma -- it is most probably a single mechanism at play
Last edited by PitOnTheProwl; 01-23-2017 at 11:05 AM.
Reason: language
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|