Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 622

1 members and 621 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,117
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 13

Threaded View

  1. #10
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    Quote Originally Posted by Marzipan View Post
    Holy moly, that is one stunning morph!
    Quote Originally Posted by Zincubus View Post
    That's so beautiful!

    I actually prefer his sister -- PurplePassion Enchi Pin female. Pretty sure this girl is a world’s first.

    Last edited by asplundii; 01-19-2017 at 09:40 AM.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    AlexisFitzy (01-19-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1