Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 2,042

1 members and 2,041 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,107
Threads: 249,255
Posts: 2,572,993
Top Poster: JLC (31,651)
Welcome to our newest member, cheeseburger
Results 1 to 10 of 13

Threaded View

  1. #4
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I have a PurplePassion Pinstripe that is pretty much patternless (has a faint dorsal stripe) and a PurplePassion that has very little pattern.

    GStripe BlkPastel and GStripe Cinny seem to be pretty consistently low pattern
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Marzipan (01-18-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1