Ooh can I play?? Won't have her for a bit as have to order another enclosure but this is my new girl- Super Pastel Pied maybe Leopard. My black pewter het pied would be next. My Black Pewter
Albert Clark (01-17-2017)
Banana spider enchi mojave male, hopefully the father of many clutches
Hlow87 (01-17-2017),jbzapanda (01-17-2017)
WhiskeyTango and Wyvern. Both 5-gene animals
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
Hlow87 (01-17-2017),jbzapanda (01-17-2017),kxr (01-17-2017),tttaylorrr (01-17-2017)
Originally Posted by asplundii WhiskeyTango and Wyvern. Both 5-gene animals Are you willing to say what genes are there? They're very pretty! Sent from my iPhone using Tapatalk
Last edited by kxr; 01-17-2017 at 09:13 AM.
This is my 4 gene male CG Enchi Leopard Spider, hopefully it will lead to some insane clown combos. Sent from my iPhone using Tapatalk
Originally Posted by kxr Are you willing to say what genes are there? They're very pretty! Whiskey (on the left) is Butter OD Pastel Woma YB. Wyvern (on the right) is Butter Enchi OD Pastel YB.
Hlow87 (01-17-2017),kxr (01-17-2017)
Forum Rules