» Site Navigation
2 members and 1,470 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,063
Threads: 249,215
Posts: 2,572,765
Top Poster: JLC (31,651)
|
-
Ooh can I play?? Won't have her for a bit as have to order another enclosure but this is my new girl- Super Pastel Pied maybe Leopard. My black pewter het pied would be next.

My Black Pewter
-
The Following User Says Thank You to chakup For This Useful Post:
Albert Clark (01-17-2017)
-
Banana spider enchi mojave male, hopefully the father of many clutches 
-
The Following 2 Users Say Thank You to Aste88 For This Useful Post:
Hlow87 (01-17-2017),jbzapanda (01-17-2017)
-
WhiskeyTango and Wyvern. Both 5-gene animals
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 4 Users Say Thank You to asplundii For This Useful Post:
Hlow87 (01-17-2017),jbzapanda (01-17-2017),kxr (01-17-2017),tttaylorrr (01-17-2017)
-
Re: What's the Highest combo morph you own with picture
 Originally Posted by asplundii
WhiskeyTango and Wyvern. Both 5-gene animals

Are you willing to say what genes are there? They're very pretty!
Sent from my iPhone using Tapatalk
Last edited by kxr; 01-17-2017 at 09:13 AM.
-
-
BPnet Veteran
Re: What's the Highest combo morph you own with picture

This is my 4 gene male CG Enchi Leopard Spider, hopefully it will lead to some insane clown combos.
Sent from my iPhone using Tapatalk
-
The Following 2 Users Say Thank You to mdb730 For This Useful Post:
Hlow87 (01-17-2017),jbzapanda (01-17-2017)
-
Re: What's the Highest combo morph you own with picture
 Originally Posted by kxr
Are you willing to say what genes are there? They're very pretty!
Whiskey (on the left) is Butter OD Pastel Woma YB.
Wyvern (on the right) is Butter Enchi OD Pastel YB.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
Hlow87 (01-17-2017),kxr (01-17-2017)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|