Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 655

1 members and 654 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,107
Posts: 2,572,117
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 23
  1. #11
    BPnet Veteran MootWorm's Avatar
    Join Date
    12-15-2012
    Location
    Phoenix, AZ
    Posts
    1,365
    Thanks
    325
    Thanked 512 Times in 418 Posts
    Images: 10

    Stabbed myself with used needle

    ^^ wholeheartedly agree. Cats are wayyy worse. I wouldn't worry too much. There are very few diseases that can affect both species. I'd be more concerned with any bacteria on your skin working its way into the wound. Just keep it clean, toss some triple antibiotic ointment on it, and like everyone says, if it changes/worsens, get a doc to check that bad boy out. And maybe get some safety needles next time

    References: I've worked in vet hospitals for many years and have a degree in biology.

  2. #12
    BPnet Royalty Mike41793's Avatar
    Join Date
    12-15-2011
    Posts
    16,925
    Thanks
    6,667
    Thanked 7,981 Times in 5,584 Posts

    Stabbed myself with used needle

    Wash the wound out with rubbing alcohol, pack it with a paste made of salt and hand sanitizer, and then seal it with Krazy Glue. Like a boss.
    1.0 normal bp

  3. #13
    BPnet Senior Member Archimedes's Avatar
    Join Date
    12-29-2012
    Location
    York, PA
    Posts
    2,073
    Thanks
    922
    Thanked 859 Times in 614 Posts
    Images: 1

    Re: Stabbed myself with used needle

    Quote Originally Posted by Mike41793 View Post
    Wash the wound out with rubbing alcohol, pack it with a paste made of salt and hand sanitizer, and then seal it with Krazy Glue. Like a boss.
    If I ever need to apply first aid to my enemy, I'll come to you first, Mike.
    1.1 Ball Pythons
    a) Calliope 0.1, Banana Ball, 2018/19 season, 600g
    b) Geralt 1.0 Chocolate Sable Mojave pos. Trick ball, May 27th 2020

    3.2 Cats (Fury, Leviathan, Walter, Chell, Amelie); 2.0 Dogs (Bjorn, Anubis); 2.1 Ferrets (Bran, Tormund, Arya); 0.1 Beardie (Nefertiti); 0.1 Slider Turtle (Species uncertain) (Papaya); 2.0 Hermit Crabs (Tamatoa, Sushi); 0.1 Conure (Mauii); Two Axolotyls (Quetzl and Unnamed); Two Tree Frogs (Pluto and Colossus); One Anole (Zeus); One Crestie (Noferatu); 3.0 Guinea Pigs (Paco, Poncho and Piccolo); 0.1 Pink Toe T (Azula)

    Fish:
    1.1 Oscar Cichlids (Rocky 1.0, hx2020, Red Fire, and Bubble 0.1, hx2019, Tiger), 1.1 Convict Cichlids (Hurley and Sloane), 0.1 Strawberry Peacock Cichlid (Comet), Two Plecos, Rubby the Rubbernose Pleco and Trinidad the common Pleco, 2.0 Upside Down Catfish (Poseidon, Neptune), One Red Parrot Cichlid (Firefly), 1.0 Betta Fish (Jenkins),
    2.2 Cherry Barbs ("The Worst"), 1.0 Electric Blue Acara (Goldeneye)

  4. The Following User Says Thank You to Archimedes For This Useful Post:

    Annarose15 (07-02-2013)

  5. #14
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    In terms of catching something viral you need not worry. The fundamental differences in biology/physiology between ectotherms and endotherms acts as a host barrier.

    In terms of bacteria, your risk is the same as if you had stepped on a nail or something. Most likely candidate infections are Pseudomonas, Salmonella and Staph. aureus. Less likely would be tetanus, Strep. pyogenes and maybe Pasteurella.


    Wash the site, treat with Neosporin and keep an eye on it. If it gets inflamed then go to the doctor.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #15
    Avian Life Neal's Avatar
    Join Date
    11-23-2008
    Location
    Louisiana
    Posts
    7,088
    Thanks
    603
    Thanked 2,145 Times in 1,559 Posts
    Blog Entries
    8
    Images: 1
    Read my thread I'll be posting in about 20 minutes, you'll laugh.
    -Birds-

    0.1 - Poicephalus senegalus - Stella (Senegal Parrot)
    0.1- Poicephalus rufiventris - Alexa (Red-bellied Parrot)



  7. #16
    BPnet Royalty Mike41793's Avatar
    Join Date
    12-15-2011
    Posts
    16,925
    Thanks
    6,667
    Thanked 7,981 Times in 5,584 Posts

    Stabbed myself with used needle

    Quote Originally Posted by Archimedes View Post
    If I ever need to apply first aid to my enemy, I'll come to you first, Mike.
    Thats how i apply first aid to myself, and I'm still alive.
    1.0 normal bp

  8. The Following User Says Thank You to Mike41793 For This Useful Post:

    Archimedes (07-02-2013)

  9. #17
    BPnet Veteran TJ_Burton's Avatar
    Join Date
    09-19-2012
    Posts
    614
    Thanks
    207
    Thanked 465 Times in 225 Posts
    I just stabbed my own hand the other night with a needle that I used to inject f/t feeder rats with Panacur 100 for preventative parasite treatment in new animals... I SURVIVED! lol. Nothing happened at all really, just a little itchy from stabbing myself with a needle, but that subsided after an hour or so.
    ~TJ~ Visit me on facebook! or Tweet me @MBReptiles

    The Favorites:
    Ball Pythons Western Hognose
    1.0 Lithium Blaze
    1.0 Bee
    1.0 Spotnose
    1.0 Enchi
    0.1 Super Cinnamon
    0.2 Pastel
    0.3 Cinnamon
    0.1 Mojave
    0.1 Pinstripe
    0.1 Spotnose
    0.1 Het Hypo
    0.2 Het Pied
    1.1 Red Albino
    1.1 Orange Albino
    1.0 Albino Het Snow
    0.1 Het Snow
    1.0 Anaconda Het Albino
    0.1 Anaconda
    1.1 Het Pink Pastel
    0.5 Het Albino
    1.0 Het Snow
    0.1 Red Phase
    0.1 Pink Phase
    0.1 Green Phase

  10. #18
    BPnet Lifer Annarose15's Avatar
    Join Date
    06-25-2010
    Location
    Gainesville, GA
    Posts
    3,632
    Thanks
    1,537
    Thanked 1,708 Times in 1,206 Posts

    Stabbed myself with used needle

    Quote Originally Posted by TJ_Burton View Post
    I just stabbed my own hand the other night with a needle that I used to inject f/t feeder rats with Panacur 100 for preventative parasite treatment in new animals... I SURVIVED! lol. Nothing happened at all really, just a little itchy from stabbing myself with a needle, but that subsided after an hour or so.
    At least now you know your hand is worm-free!
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~



  11. #19
    BPnet Veteran Diamond Serpents's Avatar
    Join Date
    09-20-2011
    Location
    Behind You
    Posts
    631
    Thanks
    125
    Thanked 250 Times in 206 Posts

    Re: Stabbed myself with used needle

    Quote Originally Posted by Mike41793 View Post
    I'm no doctor, but I would raise more concern over a cat scratch than an incident like this.

    Cat Scratch Feverrrrrr!
    This, and why would you wait and ask on a forum lol? Some where in your mind it said you'll be ok but you wanted to check with the internet. You'll be fine I promise, no matter what any one says on here just look for a infection everyday till healed and slap some neosporin and a band aid on it. Just man mode it imo
    -Brian-



  12. #20
    Registered User
    Join Date
    01-06-2013
    Posts
    23
    Thanks
    1
    Thanked 8 Times in 3 Posts

    Re: Stabbed myself with used needle

    Quote Originally Posted by BTennant View Post
    This, and why would you wait and ask on a forum lol? Some where in your mind it said you'll be ok but you wanted to check with the internet. You'll be fine I promise, no matter what any one says on here just look for a infection everyday till healed and slap some neosporin and a band aid on it. Just man mode it imo
    I figured the chance was slim, just wanted to make sure there wasn't a rare communicable disease I had never heard of. Although pretty bloody (I think the needle bent as it went into the vein), there hasn't been any inflammation or signs of any infection. I think I'll survive. Although, I was feeding my snakes yesterday and my mouth started watering and I got really hungry.

    I am going to go curl up lay down under a blanket in the dark, all this open space and light is making me uncomfortable.

  13. The Following 2 Users Say Thank You to DJone2 For This Useful Post:

    Annarose15 (07-02-2013),Archimedes (07-02-2013)

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1