Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 680

0 members and 680 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,905
Threads: 249,105
Posts: 2,572,114
Top Poster: JLC (31,651)
Welcome to our newest member, Pattyhud
Results 1 to 10 of 153

Threaded View

  1. #28
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    To go from DNA to Protein:

    http://bioinformatics.picr.man.ac.uk...converter.html


    To go from Protein to DNA:

    http://www.gregthatcher.com/Bioinfor...Translate.aspx



    Small note: For those not familiar with the genomic "alphabet", the letter M pulls double duty. If it is found at the beginning of a sequence it means "Begin". If it is found within a sequence it is simply M
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    dr del (05-23-2013),foobar (05-24-2013),Slowcountry Balls (05-23-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1