» Site Navigation
0 members and 792 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,049
Threads: 249,209
Posts: 2,572,699
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
|
-
05-23-2013, 11:36 AM
#131
What are Pieds? (Jinx)
 Originally Posted by TessadasExotics
Atgagtataagaaacataacctggataacatggataacgcatacccatgagccacacgattaaatgagcatcggccatac ccttgagtcatcggccaacgacgacgaggcgttctag
Is that the pied DNA sequence? Lol
I mean immaturity is funny but come on.
-
-
05-23-2013, 11:58 AM
#132
Atgagtataagaaacataacctggataacatggataacgcatacccatgagccacacgattaaatgagcatcggccatac ccttgagtcatcggccaacgacgacgaggcgttctag
Translates to
Begin: SIR NIT WIT WITH THE PHD. Begin: SIGHTLESS AND DEAF.
I stand by my above statement: blatantly petty, spiteful, vindictive, malicious, snarky and petulant
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
satomi325 (05-23-2013),snakesRkewl (05-23-2013)
-
05-23-2013, 12:17 PM
#133
Registered User
Well, I think Tessedas can be dismissed as just trolling at this point.
-
-
05-23-2013, 12:19 PM
#134
Re: What are Pieds? (Jinx)
 Originally Posted by asplundii
Atgagtataagaaacataacctggataacatggataacgcatacccatgagccacacgattaaatgagcatcggccatac ccttgagtcatcggccaacgacgacgaggcgttctag
Translates to
Begin: SIR NIT WIT WITH THE PHD. Begin: SIGHTLESS AND DEAF.
I stand by my above statement: blatantly petty, spiteful, vindictive, malicious, snarky and petulant
Wow, really? If it was meant to be some kind of joke, not terribly funny...
Out of curiosity is there an online translator for this sort of thing?
-
-
05-23-2013, 12:33 PM
#135
BPnet Veteran
If mine made no sense please forgive me.. I went 24 hours trying to quit smoking cold turkey... I have since smoked 4 cigarettes then and i like turtles
-
-
05-23-2013, 02:21 PM
#136
Re: What are Pieds? (Jinx)
 Originally Posted by Royal Hijinx
Wow, really? If it was meant to be some kind of joke, not terribly funny...
Out of curiosity is there an online translator for this sort of thing?
Haven't found a translator, but this will help if you've got time:
http://www.ncbi.nlm.nih.gov/staff/ta...ettercode.html
-
-
05-23-2013, 03:19 PM
#137
To go from DNA to Protein:
http://bioinformatics.picr.man.ac.uk...converter.html
To go from Protein to DNA:
http://www.gregthatcher.com/Bioinfor...Translate.aspx
Small note: For those not familiar with the genomic "alphabet", the letter M pulls double duty. If it is found at the beginning of a sequence it means "Begin". If it is found within a sequence it is simply M
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
dr del (05-23-2013),foobar (05-24-2013),Slowcountry Balls (05-23-2013)
-
05-23-2013, 06:12 PM
#138
Re: What are Pieds? (Jinx)
Asplundii wrote:
Paul,
Most textbooks have fallen into a poor example of co-dominance, that being the red/white flower analogy. This is not co-dominance but incomplete dominance. Co-dominance and incomplete dominance are two separate things and not terms that can be used interchangeably.
I really do not have it in me right now to go in to the nitty gritty details but in a nutshell co-dom is a relationship that can only occur between two independently dominant alleles. Like the A and B blood types: A is dominant, B is dominant. Neither A nor B alone are co-dominant, they are only co-dominant with relation to each other. As such, no morphs in the hobby are known to be co-dominant.
I agree with the first paragraph with one exception. Codominance and incomplete dominance are two separate things biochemically. I specified that AS FAR AS THE BREEDER IS CONCERNED, they can be lumped together. This is because the breeding patterns are the same. And often the biochemists have not determined which a particular mutant is, leaving the breeder unable to classify a mutant gene specifically.
We disagree on the definition of codominance.
As far as I can tell, the biochemists define codominance as having one phenotype for each of the AA, Aa, and aa genotypes. And both genes produce functional products.
The biochemists define incomplete dominance as having one phenotype for each of the AA, Aa, and aa genotypes. And only one gene produces a functional product.
The A and B human blood types are among the oldest codominant mutants. But they are two genes in a three gene set. A is dominant to O, and B is dominant to O. Those are irrelevant to classifying A as codominant to B. Only two genes are compared when classifying one as dominant, recessive or codominant (incomplete dominant, overdominant, etc.) to the other. Changing one of the genes can change the classification. A is dominant to O. A is codominant to B. Changing O to B changes the classification of A.
There are biochemically codominant (not incomplete dominant) mutant genes that are recessive to the corresponding wild type gene. Siamese, Burmese and normal in cats, for example.
The mutant gene for sickle cell trait is biochemically codominant (not incomplete dominant) to the corresponding normal gene.
-
-
05-23-2013, 06:23 PM
#139
BPnet Veteran
Re: What are Pieds? (Jinx)
 Originally Posted by Coopers Constrictors
Huh? Any and all Hets have the possibility to do weird things to other mutations, but that is all...
Leopards are IN FACT allelic with Piebalds. Therefore, all Leopards are basically Het Pied.
Pieds and Clowns are recessive... Period. I don't know why people are misinterpreting and over thinking proven information that has been around for decades now. Just because they may have the ability to have 'markers' and 'clean things up a bit' DOES NOT make them "codom" (btw... the proper term is Incomplete-Dominant, not codom)
I second the below text...
Well I would just like to say that incomplete dominance is the dominant allele incompletely dominating the recessive allele to create a blending effect. If the pied is considered a codominant, then it's not incomplete dominant because it possesses the dominant allele. That is codominance not incomplete dominance, but it's a common belief.
Last edited by MorphMaster; 05-23-2013 at 06:24 PM.
-
-
05-23-2013, 06:38 PM
#140
Coopers Constrictors
Pieds and Clowns are recessive... Period. I don't know why people are misinterpreting and over thinking proven information that has been around for decades now.
Proven by who?
How dare anyone challenge the status quote 
Just because they may have the ability to have 'markers' and 'clean things up a bit' DOES NOT make them "codom" (btw... the proper term is Incomplete-Dominant, not codom)
It's not the ability to have them, they all show them no different than a yellowbelly, or spark, or paint shows their markers reliably.
I can't attest to pieds but het clowns are all visual, If you produce enough of them it becomes quite obvious.
Jerry Robertson

-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|