» Site Navigation
0 members and 1,861 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,098
Threads: 249,241
Posts: 2,572,926
Top Poster: JLC (31,651)
|
-
Is the clown gene expressed in a het? Is hypo expressed in a het hypo? Is pied expressed in a het ? Absolutely not.
Absolutely they are in every single example, including the photo's I've already shared.
The photo's do not lie, believe what you want, some of us have open minds and will continue to fuel progress in this hobby.
Is it not completely obvious in those pictures what adding het clown does to the yellowbelly's?
How many recessive snakes have you produced, or are you just reading books?
Jerry Robertson

-
The Following 2 Users Say Thank You to snakesRkewl For This Useful Post:
BHReptiles (05-20-2013),interloc (05-20-2013)
-
Re: What are Pieds? (Jinx)
 Originally Posted by TessadasExotics
Also like I said. Do a little research on genetics. Learn what incomplete dominance does. Learn what dominance does. And apparently what a simple recessive is.
Discussions like this in an open forum is horrible to our hobby. We already use enough wrong terms. Why give other people wrong or missguided information to make it worse? Most people think that ball python males are "breedable" because they are producing "sperm pluggs". Ball pythons DO NOT produce sperm pluggs. Those hemipene sheds are not pluggs. If ball pythons produced sperm pluggs you could NOT have multiple fathered clutches.
Incomplete dominance occurs when the phenotype of the heterozygous genotype is distinct from and often intermediate to the phenotypes of the homozygous genotypes. (took that from good ol' wikipedia)
How does what is going on in het Pieds, het Clowns etc... NOT meet this definition?
How on earth is a discussion about ANYTHING where we examine our thought process "horrible to our hobby" that is possibly the most closed-minded statement I have heard in some time, I am currently in a land full of religious extremists.
If YOU choose not to entertain other thought processes on how the genetics of the Ball Python may actually be behaving, that is fine. But to come here and say we are damaging the hobby with our discussion is ridiculous.
Also, I will agree we use technically incorrect terms a lot, but this thread is not talking about that. You are trying to lump in all of that to this conversation, and I fail to see how it applies.
-
The Following 7 Users Say Thank You to Royal Hijinx For This Useful Post:
asplundii (05-20-2013),BHReptiles (05-20-2013),eatgoodfood (05-20-2013),HypoLyf (05-20-2013),interloc (05-20-2013),satomi325 (05-20-2013),whispersinmyhead (05-21-2013)
-
Re: What are Pieds? (Jinx)
 Originally Posted by TessadasExotics
Lol!
Look you guys are not looking at genetics and truely understanding what they are.
The only person not looking at genetics and truly understanding it is you
 Originally Posted by TessadasExotics
Here is wiki: a recessive gene is an allele that causes a phenotype (visible or detectable characteristic) that is only seen in a homozygous genotype (an organism that has two copies of the same allele) and never in a heterozygous genotype.
 Originally Posted by TessadasExotics
By definition.
In genetics, a:recessive gene or allele is one in which the effect is not tangible, or is masked by the effects of the dominant gene. The recessivetrait may be expressed when the recessive genes are in homozygous condition or when the dominant gene is not present. That happens when anorganism inherits a pair of recessive genes from its parents.
 Originally Posted by TessadasExotics
I beg to differ. I am more of a mind that most of what we breed are simple recessive.
 Originally Posted by TessadasExotics
Just because you "might" be able to see "markers" in some snakes that are het does not make it an incomplete dominant and not a simple recessive. Is the clown gene expressed in a het? Is hypo expressed in a het hypo? Is pied expressed in a het ? Absolutely not. Those genes are NOT expressed. There may be hints as to the animal carrying the one gene for that trait, but it IS NOT expressed. It is pretty simple, cut and dry. The clown gene being "expressed" means that the simple recessive clown gene is paired and it looks like a clown. If it does not have BOTH copies of that gene, it is not expressed.
All of these statements prove that you do not really understand genetics. And relying on Wiki to give you answers when you already do not understand you are talking about is just adding to your misunderstanding
 Originally Posted by TessadasExotics
Most of the morphs are actually recesive IMO.
No. Most of the morphs we work with are incomplete-dominant
 Originally Posted by TessadasExotics
The genetic terms used in the ball python world are already wrong. So why try to make things worse?
 Originally Posted by TessadasExotics
Also like I said. Do a little research on genetics. Learn what incomplete dominance does. Learn what dominance does. And apparently what a simple recessive is.
Discussions like this in an open forum is horrible to our hobby. We already use enough wrong terms. Why give other people wrong or missguided information to make it worse?
Mayhaps you ought to take your own advice and not proclaim incorrect information as if it were fact?? You do not know what you are talking about so kindly quit telling all of us that we are the problem
 Originally Posted by TessadasExotics
A het clown does NOT look like a clown. A het pied does NOT look like a Pied. A mojave does NOT look like a BEL. and the list goes on.
That does not make any of these recessive.
 Originally Posted by TessadasExotics
You can not change genetics. Pieds are recessive. Albinos are recessive. Laves are. Carmels are. Axanthics are.
The only thing "changing" is peoples view/understanding.
 Originally Posted by TessadasExotics
So explaine then what is a recessive trait? What is a "codominant", and what is a dominant?
Simple
Recessive: A gene where the phenotype is only visible when heteroallelic
---Example: Albino at tyr locus. Only when two copies of the Albino gene are present is there a phenotype
And I will use the exact same locus to explain/define Dominant
Dominant: A gene where the phenotype is the same when it is heteroallelic and homoallelic
---Example: WT at the tyr locus. A snake that is genetically heterozygous for Albino (WT/Alb) looks no different than a snake that is genetically homozygous WT (WT/WT)
Incomplete-Dominant: A gene that expresses a phenotype in the heteroallelic form that is different than the homoallelic form
---Example: BluEL allele group. When one copy of the mutant gene is present you have a distinct phenotype and when two copies of the mutant gene are present you have a second, wholly different phenotype.
 Originally Posted by Coopers Constrictors
Huh? Any and all Hets have the possibility to do weird things to other mutations, but that is all...
Leopards are IN FACT allelic with Piebalds. Therefore, all Leopards are basically Het Pied.
No "basically" about it, Leopards are het Pied
 Originally Posted by Coopers Constrictors
Pieds and Clowns are recessive... Period.
But no. Pieds are inc-dom. Some of the varied Pied alleles are very subtle to be sure but they are inc-dom just the same. Clowns... I have not looked in to them enough to say for certain but the data I have seen are certainly making me lean toward them also being a very subtle inc-dom
 Originally Posted by Coopers Constrictors
I don't know why people are misinterpreting and over thinking proven information that has been around for decades now. Just because they may have the ability to have 'markers' and 'clean things up a bit' DOES NOT make them "codom" (btw... the proper term is Incomplete-Dominant, not codom)
The problem is that the information that has been around for decades has been misinterpreted/misrepresented. What is happening now is that people are trying to set things to right and are meeting with the inertia that those decades of wrong/incorrect information have wrought.
 Originally Posted by majorleaguereptiles
As for breeding them to a normal, I noticed you don't see the same heterozygous affect on a normal versus with another mutation. That's why I gave examples using supers
Brant, you make great points but I just want to jump in here for a small clarification (and I am pretty sure you will agree with what I am about to say.) When you said the above, it does not mean that there is no heterozygous effect you breed to a normal, only that the effect in normals is often very very subtle but when bred to a super that effect becomes much more apparent.
 Originally Posted by majorleaguereptiles
Lately, I've actually been hatching colorless het albinos that color with age.
This is something a little different but I am glad you bring it up. This is not an absolute for all het Albinos, it only occurs with some of them. This is a distinct Albino allele and, quite honestly, it could reasonably be argued that it is an inc-dom Albino allele. Because of the transient nature and the period which it is expressed I would guess that it is potentially a TS or O2S allele but that is just a guess.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 13 Users Say Thank You to asplundii For This Useful Post:
- + Show/Hide list of the thanked
-
4theSNAKElady (05-21-2013),BHReptiles (05-20-2013),cassafras (05-20-2013),Coleslaw007 (05-21-2013),eatgoodfood (05-20-2013),HypoLyf (05-20-2013),interloc (05-20-2013),Royal Hijinx (05-20-2013),satomi325 (05-20-2013),Simple Man (05-20-2013),snakesRkewl (05-20-2013),STjepkes (05-20-2013),whispersinmyhead (05-21-2013)
-
Re: What are Pieds? (Jinx
I've taken plenty of University genetics and animal biology courses. With that said, I still don't believe clown falls into the category of a true recessive.
However, its true that people do use the wrong terms.
Agreed 100% with Jinx,Asplundii, and Jerry.
Sent from my DROID RAZR using Tapatalk 2
Last edited by satomi325; 05-20-2013 at 11:20 AM.
-
-
What are Pieds? (Jinx)
i love this thread. i can see both sides of the argument, but i'm kind of on the fence. keep in mind, i'm a "reader" without much first hand experience in hets (yet).. but i do read. a lot. i just don't have the luxury of saying i've been in the game for a few decades. not because i havent wanted to, it's just that i wasn't conceived until the late 80s, so for me, it is a physical impossibility.
for those of you with more first hand experience arguing that these genes are not recessive: i completely understand where you're coming from on your side of the debate.. but one thing i've noticed, especially with clown and hypo "hets," is that the "het" animals are much more apparent when they also carry other incomplete dominant traits. the pastel het clowns or enchi het hypos are easier to pick out from their non-het clutch mates.. in the picture snakesrkewl posted, there seems to be a drastic difference, but those animals carry the yellowbelly gene as well. it is my understanding (granted i am a mere "reader") that the wild type looking hets are just that: of the wild type phenotype.. and for a gene to be considered incomplete dominant (completely eliminating all other variables such as other genes), when it carries only one of the genes, you don't have a wild type phenotype. i understand that many people claim they can pick out pastel het clowns, but i havent seen this claim made with "normal" het clowns, at least not often.. but it's also a good possibility i haven't read enough. can WT phenotype clown or hypo hets be picked out with any sort of accuracy? if so, then we shouldn't consider them a WT phenotype at all, and if not, would they not still be considered recessive since a WT looking snake that is het for the gene still has a normal phenotype, regardless of how that single gene may affect the appearance of a snake that already has a not so normal phenotype?
-
-
I've been thoroughly enjoying this. Great thread guys
-
-
Re: What are Pieds? (Jinx)
 Originally Posted by creepin
it is my understanding (granted i am a mere "reader") that the wild type looking hets are just that: of the wild type phenotype.. and for a gene to be considered incomplete dominant (completely eliminating all other variables such as other genes), when it carries only one of the genes, you don't have a wild type phenotype. i understand that many people claim they can pick out pastel het clowns, but i havent seen this claim made with "normal" het clowns, at least not often.. but it's also a good possibility i haven't read enough. can WT phenotype clown or hypo hets be picked out with any sort of accuracy? if so, then we shouldn't consider them a WT phenotype at all, and if not, would they not still be considered recessive since a WT looking snake that is het for the gene still has a normal phenotype, regardless of how that single gene may affect the appearance of a snake that already has a not so normal phenotype?
Creepin'
It is like I said in my post in reference to Brant's comment about breeding to a super form:
 Originally Posted by asplundii
... it does not mean that there is no heterozygous effect you breed to a normal, only that the effect in normals is often very very subtle but when bred to a super that effect becomes much more apparent.
If you know what you are looking for you can pick the hets from the non-hets in a WT breeding, the difference is there, it is just that it is very subtle. At least as far as Pied goes. As I noted above, I have not been looking in to Clowns as much so I cannot say the same with any high level of confidence for them.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
TheSnakeGeek (05-20-2013)
-
What are Pieds? (Jinx)
 Originally Posted by asplundii
If you know what you are looking for you can pick the hets from the non-hets in a WT breeding, the difference is there, it is just that it is very subtle. At least as far as Pied goes. As I noted above, I have not been looking in to Clowns as much so I cannot say the same with any high level of confidence for them.
makes sense. so i guess my question now would be.. if WT phenotype het clowns were indistinguishable from their 100% WT counterparts, yet one was able to pick out pastel or YB het clowns from other pastel, YB, or whatever non-hets, would you then consider the clown mutation incomplete dominant or recessive?
-
-
Re: What are Pieds? (Jinx)
 Originally Posted by asplundii
The only person not looking at genetics and truly understanding it is you
Actually I understand genetics quite a bit more than most people here.
All of these statements prove that you do not really understand genetics. And relying on Wiki to give you answers when you already do not understand you are talking about is just adding to your misunderstanding
I do fortunately understand quite a bit about genetics. I also do not rely on wiki for my knowledge.
No. Most of the morphs we work with are incomplete-dominant
You say they are and it is commonly accepted so, but this does not make it so. Again I refer you to look into other animals such as mice, fish or even birds. Maybe what we are really dealing with is transheterozygotes
Mayhaps you ought to take your own advice and not proclaim incorrect information as if it were fact?? You do not know what you are talking about so kindly quit telling all of us that we are the problem
My proclaiming came into this because it IS a discussion on such things. And for the simple reason that it IS fact that Albinos, Clowns, Hypos and even Pieds are recessive.
That does not make any of these recessive.
What makes them recessive is that their het phenotype is the normal wild type appearance and their hom phenotype is the said morph appearance.
The only thing "changing" is peoples view/understanding.
Simple
Recessive: A gene where the phenotype is only visible when heteroallelic Actually it is only visible when it is Homozygous.
---Example: Albino at tyr locus. Only when two copies of the Albino gene are present is there a phenotype
And I will use the exact same locus to explain/define Dominant
Dominant: A gene where the phenotype is the same when it is heteroallelic and homoallelic
---Example: WT at the tyr locus. A snake that is genetically heterozygous for Albino (WT/Alb) looks no different than a snake that is genetically homozygous WT (WT/WT)
This is a poor way to try and describe a dominant phenotype as Albino is a proven recessive trait.
Incomplete-Dominant: A gene that expresses a phenotype in the heteroallelic form that is different than the homoallelic form
---Example: BluEL allele group. When one copy of the mutant gene is present you have a distinct phenotype and when two copies of the mutant gene are present you have a second, wholly different phenotype.
I feel that this also is a bad example to use, as I feel that the whole BEL complex is being over simplified.
-
The Following User Says Thank You to TessadasExotics For This Useful Post:
irishanaconda (05-21-2013)
-
Re: What are Pieds? (Jinx)
 Originally Posted by snakesRkewl
Absolutely they are in every single example, including the photo's I've already shared.
The photo's do not lie, believe what you want, some of us have open minds and will continue to fuel progress in this hobby.
Is it not completely obvious in those pictures what adding het clown does to the yellowbelly's?
How many recessive snakes have you produced, or are you just reading books?
Actually as far as recessives we have been working with Albino, Lavender albino, Hypo, Ultramel and have just finally added clown to our list. Now granted we have not been breeding ball pythons for 10+ years, we have been following the ball python morphs since the late 90's/early 2000's. We have been around long enough to see Capone take out the market.
Just because there can be "markers" (which I might add are not 100%) for a recessive trait does not make it not recessive. They still have the WT phenotype in the het form, which is what makes them recessive. I do have an open mind, but trying to say the earth is flat when it is a known fact to be round is not sound.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|