Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 651

0 members and 651 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 89

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Freaking out!! Fire to Normal makes white snake?!!

    Quote Originally Posted by loonunit View Post
    Can the null phenomenon happen with just the male genes contributing? Most parthenogenesis involves the female genes.
    "Null" phenomenon and parthenogenesis are wholly unrelated and have nothing to do with one another.

    Quote Originally Posted by elbee View Post
    Yea, she must carry something compatible with fire.
    No necessarily

    Quote Originally Posted by elbee View Post
    Isn't the lemonback the same allele?
    Yes, it is. But it is not at all a subtle morph that could ever be mistaken for a WT

    Quote Originally Posted by elbee View Post
    I am sure there are others
    Obviously there are: Disco and Vanilla and RDR DesertLemon and Sulphur and Flame Hypo and Lucifer and Eraserhead and... But here is the thing, there is an absolute trend line these morphs follow and the more normal they look the less they react with Fire. So if that female is some type of "cryptic" BlkEL allele then she would not produce a white snake when bred to a Fire.

    Quote Originally Posted by Coleslaw007 View Post
    I can't wait to see what happens when you eventually breed that white baby.
    Fires and normals
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Coleslaw007 (05-17-2013),Redemption Reptiles (05-18-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1