Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 377

0 members and 377 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,073
Threads: 249,220
Posts: 2,572,813
Top Poster: JLC (31,651)
Welcome to our newest member, LeonoraOrdonez5
Results 1 to 10 of 89

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Freaking out!! Fire to Normal makes white snake?!!

    Quote Originally Posted by h00blah View Post
    Look up "null phenomenon". I'm not quite sure how it works, but I think you will only get one gender of snakes in that clutch.
    Just as a small clarification, "null" phenomenon does not bias the clutch to one gender or another. It is acts of parthenogenesis that are typically recognized by one gender morph clutches.


    Quote Originally Posted by Kurtilein View Post
    about the strange "null phenomenon", i need a mechanism how its supposed to happen.
    In the link Hooblah posted there is a post by me that has a second link which explains the "null" phenomenon. The "mechanism" is really very simple; a second copy of the gene (in this case the WT copy) is simply missing, by way of any of a number of means.

    Quote Originally Posted by Kurtilein View Post
    for blue eye lucys, meaning the above mentioned example of super phantoms or super mojaves popping up seemingly out of nowhere, ill go with genes like het russo as an explanation. they seemingly do just that.
    Except that Russos are quite distinct and not likely to be mistaken for WT animals. And Russo x Phantom looks nothing like a SuperPhantom.

    That and the same phenomenon has also been seen with SuperCinny/SuperBlack and it is not like there are cryptic alleles of those out there...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 3 Users Say Thank You to asplundii For This Useful Post:

    h00blah (05-19-2013),nykea (07-16-2013),Redemption Reptiles (05-18-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1