Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,112

0 members and 1,112 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

Lorri (51)

» Stats

Members: 75,945
Threads: 249,146
Posts: 2,572,378
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Page 6 of 12 FirstFirst 123456789101112 LastLast
Results 51 to 60 of 111
  1. #51
    BPnet Royalty 4theSNAKElady's Avatar
    Join Date
    01-19-2006
    Location
    my cozy hide
    Posts
    4,889
    Thanks
    231
    Thanked 1,287 Times in 921 Posts
    Images: 92

    Re: Think I'm in the process of getting ripped off...

    I hope this ends well....

    Sent from my H866C using Tapatalk 2
    ALL THAT SLITHERS - Ball Python aficionado/keeper
    breeder of African soft fur Rats. Keeper of other small exotic mammals.
    10 sugar gliders

    2 tenrecs
    5 jumping spiders
    paludarium with fish
    Brisingr the albino
    Snowy the BEL
    Piglet the albino conda hognose


    FINALLY got my BEL,no longer breeding snakes. married to mechnut450..

  2. The Following User Says Thank You to 4theSNAKElady For This Useful Post:

    ChaosAffect (05-17-2013)

  3. #52
    BPnet Lifer Annarose15's Avatar
    Join Date
    06-25-2010
    Location
    Gainesville, GA
    Posts
    3,632
    Thanks
    1,537
    Thanked 1,708 Times in 1,206 Posts

    Re: Think I'm in the process of getting ripped off...

    Quote Originally Posted by 4theSNAKElady View Post
    I hope this ends well....
    Unfortunately, even if he receives the advertised snake, the real resolution won't happen until she breeds and produces albinos (IMO). Crossing my fingers for you.
    ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~



  4. #53
    BPnet Veteran ChaosAffect's Avatar
    Join Date
    03-29-2013
    Location
    ATL Area
    Posts
    331
    Thanks
    117
    Thanked 60 Times in 53 Posts

    Re: Think I'm in the process of getting ripped off...

    Quote Originally Posted by Annarose15 View Post
    Unfortunately, even if he receives the advertised snake, the real resolution won't happen until she breeds and produces albinos (IMO). Crossing my fingers for you.
    True, but I can at least say that it's plausible that they're het Albinos. I know he has a male Albino.

    Even if they're not, 0.2 Fire, one around 500g the other around 700g, plus a bunch of random goodies for 0.1 Spider, 0.1 Normal, 1.0 Pastel, and 1.0 het Albino, all under 300g... Not a bad deal.




  5. #54
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Think I'm in the process of getting ripped off...

    Quote Originally Posted by ChaosAffect View Post
    Oh, and phones can print. I've got a cheapo HP deskjet that has software that actually lets me print to it from pretty much anywhere on my phone. It's awesome.
    Well... Learn something new every day.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #55
    BPnet Veteran scooter11's Avatar
    Join Date
    10-26-2012
    Location
    melrose, ma
    Posts
    492
    Thanks
    58
    Thanked 195 Times in 120 Posts

    Re: Think I'm in the process of getting ripped off...

    That sounds to good to be true. Unless he's been monitoring this thread and felt he really had to make up for it

    Sent from my EVO using Tapatalk 2

  7. #56
    BPnet Veteran ChaosAffect's Avatar
    Join Date
    03-29-2013
    Location
    ATL Area
    Posts
    331
    Thanks
    117
    Thanked 60 Times in 53 Posts

    Re: Think I'm in the process of getting ripped off...

    Quote Originally Posted by asplundii View Post
    Well... Learn something new every day.
    I know, right? I thought it was SOOO cool when I saw that. Just the other day I was thinking that my current phone, a Galaxy S3, is probably 1,000 times more powerful than my first computer from 1990.
    Quote Originally Posted by scooter11 View Post
    That sounds to good to be true. Unless he's been monitoring this thread and felt he really had to make up for it

    Sent from my EVO using Tapatalk 2
    Well, there was mention of getting the police involved. He came in right under the wire on that one, too. Plus, I think he's trying to salvage his reputation. He's got a long way to go, but in the end Stuff does happen, we all make mistakes, and if he goes above and beyond to try to satisfy an angry customer then he may still have a future in this business.




  8. #57
    BPnet Veteran
    Join Date
    08-14-2012
    Location
    NEPA
    Posts
    634
    Thanks
    70
    Thanked 229 Times in 204 Posts
    I hope it all works out for you.

  9. The Following User Says Thank You to dillan2020 For This Useful Post:

    ChaosAffect (05-17-2013)

  10. #58
    BPnet Senior Member Don's Avatar
    Join Date
    10-03-2007
    Location
    Richmond, Viginia
    Posts
    1,675
    Thanks
    502
    Thanked 842 Times in 542 Posts
    Images: 7
    I don't buy the "lost phone and no internet" excuse. He doesn't have any relatives or friends who have Internet access that he could use to take care of this? The local library has Internet with machines for use. If there is a will, there is a way. Be sure to keep all communications between the two of you, in case this is a problem and you have to prove your side.

    I do hope that all of this works out well for you. It is a real shame that we have so many people in this industry who don't do things the right way.

  11. #59
    BPnet Veteran ChaosAffect's Avatar
    Join Date
    03-29-2013
    Location
    ATL Area
    Posts
    331
    Thanks
    117
    Thanked 60 Times in 53 Posts

    Re: Think I'm in the process of getting ripped off...

    Quote Originally Posted by Don View Post
    I don't buy the "lost phone and no internet" excuse. He doesn't have any relatives or friends who have Internet access that he could use to take care of this? The local library has Internet with machines for use. If there is a will, there is a way. Be sure to keep all communications between the two of you, in case this is a problem and you have to prove your side.

    I do hope that all of this works out well for you. It is a real shame that we have so many people in this industry who don't do things the right way.
    Everything at this point is being taken with a GIGANTIC grain of salt. I'm definitely holding on to all communications, and the BOI thread is still there with them as well. Do I buy his excuses? Not really. In the end, though, if I end up coming out ahead on the deal it'll be worth it.




  12. #60
    BPnet Veteran ironpython's Avatar
    Join Date
    08-09-2012
    Location
    rincon Ga.
    Posts
    1,045
    Thanks
    5
    Thanked 121 Times in 98 Posts

    Re: Think I'm in the process of getting ripped off...

    Quote Originally Posted by loonunit View Post
    BoI threads are forever. I wouldn't use them lightly. Sounds like maybe he's earning one... but I agree that using it to prod him probably isn't the right thing to do. I like that you're giving him until a deadline before posting to the BoI.
    I agree.

    1.1 pastels, 1.0 lesser, 0.1 het blurry, 0.1 spider, 1.1 norm. 0.1 dinker,
    0.3 normal 1.1 pastels 0.1 spider 1.0 fire 1.0 lesser 1.0ringer 0.1RTB 1.0 Savannah monitor.

  13. The Following User Says Thank You to ironpython For This Useful Post:

    ChaosAffect (05-17-2013)

Page 6 of 12 FirstFirst 123456789101112 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1