Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 769

1 members and 768 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 1 of 3 123 LastLast
Results 1 to 10 of 28
  1. #1
    Registered User
    Join Date
    09-12-2012
    Location
    Ohio
    Posts
    62
    Thanks
    61
    Thanked 6 Times in 6 Posts
    Images: 7

    Looking for info on getting a big Sub Saharan

    I have been reading old threads on the huge 5000-8000 gram sub saharan females and curious where i look into acquiring one. Outback Reptiles is a name commonly mentioned but I could not find them on their website. I couldn't find any on kingsnake either. Does anyone on here have any or know where i could find them? Any info on these giants is appreaciated. Thanks

  2. #2
    Registered User HarrisonGust's Avatar
    Join Date
    04-09-2012
    Location
    Burke, Virginia
    Posts
    90
    Thanks
    10
    Thanked 11 Times in 10 Posts

    Looking for info on getting a big Sub Saharan

    They usually only come around a few times a year and outback is one of the only people that has them.

  3. The Following User Says Thank You to HarrisonGust For This Useful Post:

    Johnmb (04-16-2013)

  4. #3
    BPnet Veteran tikigator's Avatar
    Join Date
    05-18-2011
    Location
    Severna Park, MD
    Posts
    277
    Thanks
    50
    Thanked 52 Times in 42 Posts
    Images: 68
    Yes Outback gets them and just sold out in Feb. Usually they get them in the winter, first of the year. Contact Ian or Josh either via their website or on facebook but they will tell you to wait until next season as they are currently sold out. Its usually first come first serve I don't believe they sell in advance as they do not know what they are getting and price snakes according to size/weight and whether or not they are gravid or not. Ian and Josh are both great, i actually just picked up a wc yellowbelly girl from them on saturday. They are great to do business with and get nice imports in. Good luck!
    Last edited by tikigator; 04-16-2013 at 08:47 AM.
    Tikigator Exotics & Chondro Collective (find us on facebook!)

  5. The Following User Says Thank You to tikigator For This Useful Post:

    Johnmb (04-16-2013)

  6. #4
    Registered User
    Join Date
    09-12-2012
    Location
    Ohio
    Posts
    62
    Thanks
    61
    Thanked 6 Times in 6 Posts
    Images: 7

    Re: Looking for info on getting a big Sub Saharan

    If the info i'm looking at its correct then the gene is dominant and since i have found them in articles back to 2007 you would think that there should be babies being sold by now. I'm a bit curious why cb babies are impossible to find. Is it just because they are all spoken for before they are born or what? Thanks for the input guys!

  7. #5
    BPnet Veteran OctagonGecko729's Avatar
    Join Date
    07-30-2012
    Posts
    694
    Thanks
    593
    Thanked 243 Times in 169 Posts
    I doubt that you will get a girl over 5000g. This year they had a 4900g gravid come in and she was $800. Usually the animals run between 2800-4000g. The main reason for this is because they are highly sought after for their meat in the region. Also the hike to get up to the area where they live is pretty dangerous terrain and there are some warlords living in that area as well. Josh was telling me that one of the reasons they have had less numbers in previous years is because one of their collectors actually got murdered while he was in the region.
    5.5.13 C. Ciliatus - Specialize in Super Dals
    0.0.1 V. Exanthematicus (Skorge)
    4.4 U. Lineatus
    1.2 N. Amyae
    1.2.2 N. levis levis
    1.0 U. Pietschmanni (Pietsch)
    5.2.2 U. Fimbriatus

    Lots of BPs focusing on Clown stuff in 2014.

    1.0 P. Reticulatus 50% Dwarf Purple Albino het Gen Stripe

    Chris from The Lizard Horde
    www.thelizardhorde.com
    Our Iherp Reptile Collection
    https://www.facebook.com/TheLizardHorde

  8. The Following User Says Thank You to OctagonGecko729 For This Useful Post:

    Johnmb (04-16-2013)

  9. #6
    BPnet Veteran OctagonGecko729's Avatar
    Join Date
    07-30-2012
    Posts
    694
    Thanks
    593
    Thanked 243 Times in 169 Posts

    Re: Looking for info on getting a big Sub Saharan

    Quote Originally Posted by Johnmb View Post
    If the info i'm looking at its correct then the gene is dominant and since i have found them in articles back to 2007 you would think that there should be babies being sold by now. I'm a bit curious why cb babies are impossible to find. Is it just because they are all spoken for before they are born or what? Thanks for the input guys!

    I actually found out that the gigantism is polygenetic.

    However, we will have 11 C.H. hatchlings this week from our Volta girl (day 53 now), get em while they last though .
    5.5.13 C. Ciliatus - Specialize in Super Dals
    0.0.1 V. Exanthematicus (Skorge)
    4.4 U. Lineatus
    1.2 N. Amyae
    1.2.2 N. levis levis
    1.0 U. Pietschmanni (Pietsch)
    5.2.2 U. Fimbriatus

    Lots of BPs focusing on Clown stuff in 2014.

    1.0 P. Reticulatus 50% Dwarf Purple Albino het Gen Stripe

    Chris from The Lizard Horde
    www.thelizardhorde.com
    Our Iherp Reptile Collection
    https://www.facebook.com/TheLizardHorde

  10. The Following User Says Thank You to OctagonGecko729 For This Useful Post:

    Johnmb (04-16-2013)

  11. #7
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Looking for info on getting a big Sub Saharan

    "Giant" ball pythons are not suffering from gigantism, they are merely a local population variant that is unusually larger for the species. The phenotype in pocket populations like these are the result of selective pressures and more often than not they are polygenetic in nature. As such, offspring from these animals cannot correctly be called "giants" unless both parents are from said population.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  12. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    arialmt (04-17-2013),dante59 (04-19-2013)

  13. #8
    BPnet Veteran TessadasExotics's Avatar
    Join Date
    03-05-2010
    Location
    CT
    Posts
    1,642
    Thanks
    202
    Thanked 466 Times in 397 Posts
    Images: 214

    Re: Looking for info on getting a big Sub Saharan

    Quote Originally Posted by OctagonGecko729 View Post
    I doubt that you will get a girl over 5000g. This year they had a 4900g gravid come in and she was $800. Usually the animals run between 2800-4000g. The main reason for this is because they are highly sought after for their meat in the region. Also the hike to get up to the area where they live is pretty dangerous terrain and there are some warlords living in that area as well. Josh was telling me that one of the reasons they have had less numbers in previous years is because one of their collectors actually got murdered while he was in the region.
    Not sure where you are getting your information from, but it is highly inaccurate. Ball pythons are not highly sought after for their meat. As mater of fact try killing and eating one in Nigeria and see what would happen. Supposedly the "giant" or "sub Saharan" ball pythons are from the Volta region. (funny as the whole area that ball pythons are found is the sub saharan) This is actually a region of the south eastern part of Ghana on the border of Togo. Warlords are not rampant in this area. Ghana does have tribes and chieftains which do have conflict with each other at times. There has been a land issue between the Nkonya and the Alavanyo going on since 1923 and has just recently gotten heated again this past month. But all in all Ghana is not a very dangerous place.
    I have not seen much of a decline in the selling of these particular balls as of late. Actually seems to have picked up some. There where quite a few for sale this past year and this one so far. If you ask me they are nothing more than nice old, well fed specimens. Until someone proves them to be genetically larger than any others. We have 4 girls that are over 4kg. We have never seen any differences between the babies from them and the babies from our other smaller females.
    Lotsa Balls and more

    http://www.tessadasexotics.com/

  14. The Following 2 Users Say Thank You to TessadasExotics For This Useful Post:

    Marrissa (04-16-2013),STjepkes (04-16-2013)

  15. #9
    BPnet Veteran tikigator's Avatar
    Join Date
    05-18-2011
    Location
    Severna Park, MD
    Posts
    277
    Thanks
    50
    Thanked 52 Times in 42 Posts
    Images: 68
    What's funny to me is I know a couple people who have purchased these "sub Saharans" and they are 3000-4000g but I know a few breeders who have normal cbb ball pythons that are 4000-5000g. So I know that in that Volta region they are known to "grow larger" in general but I have a girl here at my house that is not a sub Saharan that is pushing 4000g. So I'm not really sure if the extra $$$ for a normal snake is worth it......still undecided....I personally think I would rather put that $800 towards a pied girl myself

    Edit: Tessadas I just read what you wrote...apparety you agree! Lol I also am not so sure they are not just well fed large normal ball pythons....I would be interested to see if indeed someone proved them to be genetic. They are also being sold as WC gravids laying large clutches with no slugs but my answer to that is NATURE! it's amazing how in nature snakes can become gravid, find those temps and never lay a single slugs. Something we just cannot seem to 100% accurately duplicate here in captivity.
    Last edited by tikigator; 04-17-2013 at 09:39 AM.
    Tikigator Exotics & Chondro Collective (find us on facebook!)

  16. The Following User Says Thank You to tikigator For This Useful Post:

    Johnmb (04-17-2013)

  17. #10
    BPnet Senior Member don15681's Avatar
    Join Date
    12-07-2009
    Location
    Saltsburg, Pa
    Posts
    1,410
    Thanks
    497
    Thanked 531 Times in 387 Posts
    Images: 108

    Re: Looking for info on getting a big Sub Saharan

    I purchase a female about 3 or 4 years ago, she was a very thin 749 grams. she is now over 5000 grams. I don't know which region her blood line comes from. but she's still hungry and she's a big girl. I might have to start getting my rats from nutrisystem! here's a pic of her. don





    that's a breeding size pastel clown I place with her to show her size. she's also in a cb70 tub. the water dish is at the front of the tub and the back is right behind her.

  18. The Following 2 Users Say Thank You to don15681 For This Useful Post:

    Johnmb (04-17-2013),Ronniex2 (10-08-2018)

Page 1 of 3 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1