» Site Navigation
0 members and 670 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
Looking for info on getting a big Sub Saharan
I have been reading old threads on the huge 5000-8000 gram sub saharan females and curious where i look into acquiring one. Outback Reptiles is a name commonly mentioned but I could not find them on their website. I couldn't find any on kingsnake either. Does anyone on here have any or know where i could find them? Any info on these giants is appreaciated. Thanks
-
-
Registered User
Looking for info on getting a big Sub Saharan
They usually only come around a few times a year and outback is one of the only people that has them.
-
The Following User Says Thank You to HarrisonGust For This Useful Post:
-
BPnet Veteran
-
The Following User Says Thank You to tikigator For This Useful Post:
-
Registered User
Re: Looking for info on getting a big Sub Saharan
If the info i'm looking at its correct then the gene is dominant and since i have found them in articles back to 2007 you would think that there should be babies being sold by now. I'm a bit curious why cb babies are impossible to find. Is it just because they are all spoken for before they are born or what? Thanks for the input guys!
-
-
I doubt that you will get a girl over 5000g. This year they had a 4900g gravid come in and she was $800. Usually the animals run between 2800-4000g. The main reason for this is because they are highly sought after for their meat in the region. Also the hike to get up to the area where they live is pretty dangerous terrain and there are some warlords living in that area as well. Josh was telling me that one of the reasons they have had less numbers in previous years is because one of their collectors actually got murdered while he was in the region.
-
The Following User Says Thank You to OctagonGecko729 For This Useful Post:
-
Re: Looking for info on getting a big Sub Saharan
 Originally Posted by Johnmb
If the info i'm looking at its correct then the gene is dominant and since i have found them in articles back to 2007 you would think that there should be babies being sold by now. I'm a bit curious why cb babies are impossible to find. Is it just because they are all spoken for before they are born or what? Thanks for the input guys! 
I actually found out that the gigantism is polygenetic.
However, we will have 11 C.H. hatchlings this week from our Volta girl (day 53 now), get em while they last though .
-
The Following User Says Thank You to OctagonGecko729 For This Useful Post:
-
Re: Looking for info on getting a big Sub Saharan
"Giant" ball pythons are not suffering from gigantism, they are merely a local population variant that is unusually larger for the species. The phenotype in pocket populations like these are the result of selective pressures and more often than not they are polygenetic in nature. As such, offspring from these animals cannot correctly be called "giants" unless both parents are from said population.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
arialmt (04-17-2013),dante59 (04-19-2013)
-
Re: Looking for info on getting a big Sub Saharan
 Originally Posted by OctagonGecko729
I doubt that you will get a girl over 5000g. This year they had a 4900g gravid come in and she was $800. Usually the animals run between 2800-4000g. The main reason for this is because they are highly sought after for their meat in the region. Also the hike to get up to the area where they live is pretty dangerous terrain and there are some warlords living in that area as well. Josh was telling me that one of the reasons they have had less numbers in previous years is because one of their collectors actually got murdered while he was in the region.
Not sure where you are getting your information from, but it is highly inaccurate. Ball pythons are not highly sought after for their meat. As mater of fact try killing and eating one in Nigeria and see what would happen. Supposedly the "giant" or "sub Saharan" ball pythons are from the Volta region. (funny as the whole area that ball pythons are found is the sub saharan) This is actually a region of the south eastern part of Ghana on the border of Togo. Warlords are not rampant in this area. Ghana does have tribes and chieftains which do have conflict with each other at times. There has been a land issue between the Nkonya and the Alavanyo going on since 1923 and has just recently gotten heated again this past month. But all in all Ghana is not a very dangerous place.
I have not seen much of a decline in the selling of these particular balls as of late. Actually seems to have picked up some. There where quite a few for sale this past year and this one so far. If you ask me they are nothing more than nice old, well fed specimens. Until someone proves them to be genetically larger than any others. We have 4 girls that are over 4kg. We have never seen any differences between the babies from them and the babies from our other smaller females.
-
The Following 2 Users Say Thank You to TessadasExotics For This Useful Post:
Marrissa (04-16-2013),STjepkes (04-16-2013)
-
BPnet Veteran
-
The Following User Says Thank You to tikigator For This Useful Post:
-
Re: Looking for info on getting a big Sub Saharan
I purchase a female about 3 or 4 years ago, she was a very thin 749 grams. she is now over 5000 grams. I don't know which region her blood line comes from. but she's still hungry and she's a big girl. I might have to start getting my rats from nutrisystem! here's a pic of her. don

that's a breeding size pastel clown I place with her to show her size. she's also in a cb70 tub. the water dish is at the front of the tub and the back is right behind her.
-
The Following 2 Users Say Thank You to don15681 For This Useful Post:
Johnmb (04-17-2013),Ronniex2 (10-08-2018)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|