Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 597

2 members and 595 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,117
Posts: 2,572,189
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 16

Threaded View

  1. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: question for those who don't recommend some snakes

    Quote Originally Posted by Kaorte View Post
    But couldn't you agree that the low quality pastels that result should be marked as pet quality?
    I absolutely agree with that. However...

    Quote Originally Posted by Kaorte View Post
    I'm sure breeders don't sell them for the same price as a higher quality pastel and people still buy them with the intention to breed.
    I think it depends on the breeder. I am sure some breeders do segregate, usually the smaller breeders who actually care about these kind of things. That said, I believe larger breeders are more than likely doing one of two things: 1) lumping them all together because it takes too much time to segregate them out or 2) lumping them all together because they are their specific line and that alone makes them better regardless of quality. And that latter decision is a slippery slope because then the person who buys one of those animals more often than not perpetuates that screwed logic.

    In the end it comes down to what everyone says: Only buy it if it is quality. You are the one who has to determine what that quality is... It will be different for everyone
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    don15681 (04-12-2013),Kaorte (04-12-2013)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1