Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 712

1 members and 711 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 2 of 2 FirstFirst 12
Results 11 to 16 of 16
  1. #11
    BPnet Senior Member Andybill's Avatar
    Join Date
    03-04-2012
    Location
    Shelton, Wa
    Posts
    2,958
    Thanks
    1,147
    Thanked 1,319 Times in 1,088 Posts
    Images: 7
    Ok so when considering selective breeding and how quality is affected lets just say you have a decent pastel and assuming you breed it to something that is a darker morph like say mahogany or ghi (I chose these because I think pastel GHIs and Mahoganies are just not very attractive) could a pastel be dirtied up by simply breeding it to something dark like that? I have heard a lot of different things suggesting that characteristics can be passed on without actually passing on the gene in particular. So in the case of breeding dark morphs to pastels could some of the dark characteristics be passed on to the babies even if the gene itself was not? I am not real good with genetics but I know what I like and thats what I plan to breed for. I try not to complicate things. I am not against breeding pastel to darker morphs I think it works in many cases but isnt that part of selective breeding? Deciding not to pair pastel with something because it could just muddy it up? I hope I am not confusing any body.
    -Andrew Hall-

    Good night Chesty, wherever you are....


  2. The Following User Says Thank You to Andybill For This Useful Post:

    don15681 (04-11-2013)

  3. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: question for those who don't recommend some snakes

    Quote Originally Posted by Kaorte View Post
    I don't know what your point is here. It seems most of your post is a giant run on sentence that is incomprehensible. So you are saying that brown pastels don't come from people breeding brown pastels? Because.. that is where they come from. Not to say they don't also come from multi-gene snakes, but those poor quality pastels that result should not be bred in my opinion. But people do breed them.
    The point that Kurt is making, and it is an absolutely valid one, is that when you are line-breeding you not just dealing with the morph gene alone but you are also selecting for other genes that influence that morph gene. So you can blame people who breed low-grade Pastels all you want but the blame lays just as squarely on the mass-combo makers as well.

    Morph genes do not exist in a vacuum. There are probably 18,000-20,000 genes in the ball python genome. Let us just arbitrarily say that, when line-breeding for quality, you are selecting for 100 other genes that influence a given morph. So when someone decides to shooting to make the first ever Pastel Pin Chocolate hetRedAx Spotnose BlackHead, even if they started out with the pinnacle representations of each of the individual morphs there are 600 other genes in the equation at the end point you have to account for and if you think that the 100 extra genes that make an one of those morphs superb are going to have an equally positive effect on the other five morphs then you are fooling yourself. The reality is that the "positive-influence" genes each morph is carrying are more than likely going to negatively influence the other morphs. So if you look at Pastel in this situation, what you have is 500 "negative-influence to Pastel" genes antagonizing 100 "positive-influence to Pastel" genes so any straight Pastels you generate from this breeding are more than likely going to be mediocre-grade Pastels at best.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. The Following 4 Users Say Thank You to asplundii For This Useful Post:

    Andybill (04-12-2013),don15681 (04-12-2013),Johnmb (04-16-2013),Kaorte (04-12-2013)

  5. #13
    BPnet Lifer Kaorte's Avatar
    Join Date
    09-24-2008
    Location
    Chicago
    Posts
    8,773
    Thanks
    2,211
    Thanked 2,580 Times in 1,923 Posts
    Images: 13

    Re: question for those who don't recommend some snakes

    I understand that. But couldn't you agree that the low quality pastels that result should be marked as pet quality? I'm sure breeders don't sell them for the same price as a higher quality pastel and people still buy them with the intention to breed.

    Its just frustrating for me. I feel like this is happening to other morphs as well. They are getting so degraded.

    Personally, I don't even like most combos that have more than 4 visual traits expressed. I think the 3 gene combos are the most interesting. When you get to 4 and 5 it just kinda washes some of the other genes out.

    Sent from my Galaxy Nexus using Tapatalk 2
    ~Steffe

  6. The Following User Says Thank You to Kaorte For This Useful Post:

    don15681 (04-12-2013)

  7. #14
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: question for those who don't recommend some snakes

    Quote Originally Posted by Kaorte View Post
    But couldn't you agree that the low quality pastels that result should be marked as pet quality?
    I absolutely agree with that. However...

    Quote Originally Posted by Kaorte View Post
    I'm sure breeders don't sell them for the same price as a higher quality pastel and people still buy them with the intention to breed.
    I think it depends on the breeder. I am sure some breeders do segregate, usually the smaller breeders who actually care about these kind of things. That said, I believe larger breeders are more than likely doing one of two things: 1) lumping them all together because it takes too much time to segregate them out or 2) lumping them all together because they are their specific line and that alone makes them better regardless of quality. And that latter decision is a slippery slope because then the person who buys one of those animals more often than not perpetuates that screwed logic.

    In the end it comes down to what everyone says: Only buy it if it is quality. You are the one who has to determine what that quality is... It will be different for everyone
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    don15681 (04-12-2013),Kaorte (04-12-2013)

  9. #15
    BPnet Lifer Kaorte's Avatar
    Join Date
    09-24-2008
    Location
    Chicago
    Posts
    8,773
    Thanks
    2,211
    Thanked 2,580 Times in 1,923 Posts
    Images: 13

    Re: question for those who don't recommend some snakes

    Quote Originally Posted by asplundii View Post
    I absolutely agree with that. However...



    I think it depends on the breeder. I am sure some breeders do segregate, usually the smaller breeders who actually care about these kind of things. That said, I believe larger breeders are more than likely doing one of two things: 1) lumping them all together because it takes too much time to segregate them out or 2) lumping them all together because they are their specific line and that alone makes them better regardless of quality. And that latter decision is a slippery slope because then the person who buys one of those animals more often than not perpetuates that screwed logic.

    In the end it comes down to what everyone says: Only buy it if it is quality. You are the one who has to determine what that quality is... It will be different for everyone
    Good point. I do plan on pricing my animals based on their quality. I can understand that when you start producing 100-200+ snakes a year, it can be time consuming to price them all individually.

    I'm going to continue to buy quality breeding stock and hold back animals that I think are the best possible examples of the morph so that I may continue to produce high quality animals. If/when I produce some lower quality animals, their price and description will reflect that.
    ~Steffe

  10. #16
    BPnet Veteran satomi325's Avatar
    Join Date
    08-15-2011
    Location
    In a galaxy far,far away.
    Posts
    6,423
    Thanks
    2,429
    Thanked 3,969 Times in 2,446 Posts
    Images: 5

    Re: question for those who don't recommend some snakes

    Quote Originally Posted by Kurtilein View Post
    Some people prefer line breding while others prefer to combine morphs.

    unfortunately i dont think the two can go together very well.

    What makes ugly pastels is NOT irresponsible breeders.... ugly pastels come from pewter or super pastel combos or out of multi-gene combos. A nice line-bred pastel goes on to become lemonblasts and bees, then gets bred to some stuff containing cinnamon and black pastel to hit some pewters and maybe pewter pin or something, these get bred to pied to make pewter het pied or lemonblast het pied, and then end up in a pewter pied or sterling pied.

    Some morphs can be extremely improved by line-breeding but degenerate in the combo process, other morphs are super stable in combos.

    Some breeders prefer line-breeding and want to make the picture-perfect show quality bees or lemonblasts or whatever and search for highest quality single-gene pastels, and it pays off. Some breeders care about combos and just want some pastel for pewter stuff or something. They might buy some super pastel with a third gene added, or some pewter-containing stuff, above-average looking but still, no line-breeding influence.

    *sigh*
    I've countered and rebutted this exact same statement from you before in at least two separate occasions, I don't understand why you continue to say it.....
    This is getting really tiresome.... m(___)m

  11. The Following 2 Users Say Thank You to satomi325 For This Useful Post:

    Coleslaw007 (04-12-2013),don15681 (04-12-2013)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1