» Site Navigation
2 members and 1,834 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.
» Today's Birthdays
» Stats
Members: 76,098
Threads: 249,244
Posts: 2,572,940
Top Poster: JLC (31,651)
|
-
Re: Het Platty?
 Originally Posted by Kurtilein
thanks for the info  Then the only question that remains is why its missing from WOBP.
Short answer.... WoBP has their own agenda and you can either accept it or bugger off.
 Originally Posted by Kurtilein
i think i wont call anything "platinum", ever. Too many people, and old sources, say "lesser platinum" and mean "lesser". Other people say "platinum" and mean "lesser het daddy". Other people say "lesser platinum", and mean "lesser het daddy". And then people say "mojave platinum" or "butter platinum", and all sense goes out of the window, until you realize they mean "mojave het daddy" or "Butter het daddy". So whenever you hear platinum, as a response you should hear: "and genetically its what?". Since everything that has ever been online will be found forever, to avoid confusion ill go the WOBP way: recognize that "platinum" is now meaningless due to logical conflicts, and strike it down. Ill allow & use "platty daddy", two words two genes, but ill probarbly just call it "lesser het daddy" 
If you know the full history of Platty it all makes sense. Read RDR's pages for the full version but in brief; Lesser Platinum is the proper name for Lessers, RDR coined it when the first clutch from PlattyDaddy hatched out because the obviously visual offspring were "less than" Platinums. But as is common for BP breeders, everyone got lazy and just started calling them Lessers. The enigma of the Daddy gene boggled so many minds that it got bastardized over the years but RDR has been pretty consistent in calling it Daddy (Like when he made the Butter version, he called them ButterDaddy) and he has taken to calling the gene carriers het Daddy. The only divergence is where he calls the PhantomDaddy "Phantom44" because they were produced in clutch 44 of that year.
 Originally Posted by Kurtilein
This thread now caused me to open a new thread that is somehow related.... a german breeder is selling 100% het black eye lucy. Makes black-eyed lucys when it hits the fire-gene. Might be a new gene or something else.
I just discussed a similar occurrence on a different forum. I would bank on it being just another allele in the hetBlkEL complex. What is the phenotype of the BlkEL it makes? High/low/no-orange? That would tell you where it likely lies in the spectrum of the known hetBlkELs
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|