Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 566

0 members and 566 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,115
Posts: 2,572,187
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 19

Thread: Het Platty?

Threaded View

  1. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Het Platty?

    Quote Originally Posted by interloc View Post
    Is there a super daddy? Surely if it is in fact a part of the BEL group then it would have a super of some sort.

    Quote Originally Posted by Kurtilein View Post
    there really should be one, and it should not be hard to produce. If you breed a lesser het daddy to lesser het daddy, you get: 25% super lesser (BEL), 50% lesser het daddy, and 25% super het daddy. In such a pairing you are guaranteed to only get 2-gene animals, and whatever offspring doesnt look like a lesser or blue eye lucy MUST be a super het daddy. (and for the minimal chance that super daddy is lethal/absent, which i dont believe since the gene is sooooo subtle, you could prove that out with the same pairing: you should then only get super lessers and lesser het daddy, with 33%/66% odds, and never get anything else).

    Kurt, eaisier to say Platty x Platty which gives you three possible outcomes: Platty, SuperLesser and SuperDaddy

    SuperDaddy has been done. RDR did it in... 2004 I think and has done it a couple times since as well. The super is phenotypically not much to look at, I dare say 99.5% of people would say it is nothing more than a normal. But like I said, weakest allele in the BluEL clade.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:


Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1