Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 580

1 members and 579 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,916
Threads: 249,118
Posts: 2,572,200
Top Poster: JLC (31,651)
Welcome to our newest member, Wilson1885
Page 4 of 6 FirstFirst 123456 LastLast
Results 31 to 40 of 51
  1. #31
    BPnet Veteran
    Join Date
    10-03-2011
    Posts
    1,426
    Thanks
    21
    Thanked 7 Times in 1 Post
    Images: 36

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by Jabberwocky Dragons View Post
    Here's a link to the actual study if anyone is interested in reading it:

    http://mbio.asm.org/content/3/4/e00180-12#xref-fn-1-1

    Although it is still unclear how IBD is transmitted, the authors do bring up mites and infected rodents used for feeding as possible transmission vectors.
    After having a horrible experience with "a big name online feeder company" I found a local herp guy who breeds his own mice and rats and buy from him exclusively.
    His feeders are beautiful, healthy animals, some of which, especially the fancy colored rats, I'd be happy to have had as live pets as they've excelled anything I've ever seen in the pet stores.

    Somewhere around here is a thread I started with photos of the mice who had bald spots, "holes", lumps, weird red 'rashes' and gad-knows-what-else wrong with them and some of them had numbers tattooed on their tails.[WTH?]

    I wasted $40 on those mice because not a single snake would eat them.

    Unfortunately I couldn't get my money back because I bought them from a guy who had overstock and he was the original purchaser.

  2. #32
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts
    I rarely post here so there is a high likelihood that many/most here do not know who I am and so you will probably question my credibility. So be it. Those of you who do know who I am will understand why I am posting now. To anyone who wants to know more about me and my credibility, you can find my postings in other haunts.

    Now, on with the show.

    I have read the actual research article and I can assure you that the science behind it is absolutely accurate. This is not some smokescreen money-laundering, sheep:cens0r::cens0r::cens0r::cens0r:ers propaganda as Skip is trying to make people believe. I would bet good money that Skip did not even bother to read the real article and is just going off of the major media garbage that is floating around out there. And as far as Skips linking to things Jeff has said in the past... I would love to see Jeff's PhD that gives him the authority to decide anything about microbiology, infectious diseases, genetics, or any science for that matter. Just because Jeff keeps snakes does not mean he knows one whit about science. And something Jeff said 7 years ago should not be held as absolute fact today. The world is not static, new information is learned all the time and people can and do change their minds. And if Jeff still wants to say that IBD is not real and if Skip still wants to say that this article is bull:cens0r::cens0r::cens0r::cens0r:... So be it. Facts do not change simply because you chose to ignore them.


    To clear up some of the things I have seen people here asking/saying...

    The study does not definitively identify these viruses as the source for IBD. However, it does postulate that these viruses are a very likely candidate hence the specific choice of words in the title of the article. The only thing missing to prove the newly discovered agents are the cause would be by executing Koch's Postulate. As reactive as the herp world is I am not surprised that the authors did not set out to do that, they did the next best thing however with their work on cultured cells.

    The viruses described in the article are a new clade of a family of viruses that, until now, has only been found in mammals, primarily, but not exclusively, rodents. Think of it as basically being a newly discovered species related to a know species. It is never really a surprise when a new species is discovered, it is only a surprise when one is discovered somewhere no one bothered to look on the assumption that there was nothing there. And that last is exactly what happened here, it was assumed that these types of viruses only occurred in mammals so no one ever bothered looking for them anywhere else. the great thing about science is that it is self-correcting. So, in addition to finding a new clade of viruses we have also corrected a mistaken assumption that this type of virus can only be found in mammals.

    It is extremely unlikely that the specific viruses discovered and described in the article are transmitted or even able to be carried by rodents (or humans for that matter). Viruses are very host-specific and do not often jump species and those viruses that do jump are most often between self-similar animals. So the potential for a virus that is specific to the unique cellular biochemistry found in a reptile to jump into a mammalian host is on the none side of a slim to none chance. If you have even a basic comprehension of cladistics then the the phylogeny trees in the article will further support the unlikelihood. If you do not understand phylogeny trees then think of it like this: starting with yourself, go backwards on your own family tree eight generations and then climb back up by an entirely different path. You and the person you come back to are technically "family" but your are about as related to them as you are to me. It is that same degree of "family" that GGV and CASV have with the known mammalian viruses in this family. So put to rest any ideas that animals are getting IBD from bad feeder rodents.


    My biggest suggestion is that people who are interested read the actual article at the link that was posted. If you have questions about it, ask someone who knows what they are talking about. Not some wanker like Skip who quite obviously has an axe to grind
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  3. The Following User Says Thank You to asplundii For This Useful Post:

    WarriorPrincess90 (08-16-2012)

  4. #33
    BPnet Veteran Jabberwocky Dragons's Avatar
    Join Date
    01-17-2012
    Location
    VA
    Posts
    404
    Thanks
    69
    Thanked 276 Times in 158 Posts
    Images: 9
    There are several viruses that are able to transmit between different families, such as West Nile. Avians are not that evolutionary different from Reptiles (relatively speaking) so there's really nothing impossible about a multi species virus that can infect both reptiles and mammals. I'm not saying this is the case, but it's a little foolish to immediately strike it out as a possibility, however remote. The authors who published the study haven't done so.
    Last edited by Jabberwocky Dragons; 08-16-2012 at 09:29 AM.

  5. #34
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by asplundii View Post
    I rarely post here so there is a high likelihood that many/most here do not know who I am and so you will probably question my credibility. So be it. Those of you who do know who I am will understand why I am posting now. To anyone who wants to know more about me and my credibility, you can find my postings in other haunts.
    I can vouch for asplundii's credibility

  6. #35
    Reptiles EVERYWHERE! Foschi Exotic Serpents's Avatar
    Join Date
    05-17-2009
    Location
    Joliet, IL.
    Posts
    5,170
    Thanks
    2,039
    Thanked 1,993 Times in 1,292 Posts
    Images: 64
    I thought Skip was being sarcastic.. Not actually agreeing with Jeff that is.

  7. #36
    BPnet Veteran wwmjkd's Avatar
    Join Date
    06-21-2011
    Location
    DC
    Posts
    589
    Thanks
    257
    Thanked 259 Times in 192 Posts
    Images: 6

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by OhhWatALoser View Post
    I can vouch for asplundii's credibility
    he might be credible but apparently he's not yet encountered uncle skippy in his other haunts. or bothered to read the link he posted detailing his own experience with the disease. but either way, the tone was pretty clearly sarcastic false bravado.

  8. #37
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by ASSplundii View Post
    I rarely post here so there is a high likelihood that many/most here do not know who I am and so you will probably question my credibility. So be it. Those of you who do know who I am will understand why I am posting now. To anyone who wants to know more about me and my credibility, you can find my postings in other haunts.

    Now, on with the show.

    I have read the actual research article and I can assure you that the science behind it is absolutely accurate. This is not some smokescreen money-laundering, sheep:cens0r::cens0r::cens0r::cens0r:ers propaganda as Skip is trying to make people believe. I would bet good money that Skip did not even bother to read the real article and is just going off of the major media garbage that is floating around out there. And as far as Skips linking to things Jeff has said in the past... I would love to see Jeff's PhD that gives him the authority to decide anything about microbiology, infectious diseases, genetics, or any science for that matter. Just because Jeff keeps snakes does not mean he knows one whit about science. And something Jeff said 7 years ago should not be held as absolute fact today. The world is not static, new information is learned all the time and people can and do change their minds. And if Jeff still wants to say that IBD is not real and if Skip still wants to say that this article is bull:cens0r::cens0r::cens0r::cens0r:... So be it. Facts do not change simply because you chose to ignore them.


    To clear up some of the things I have seen people here asking/saying...

    The study does not definitively identify these viruses as the source for IBD. However, it does postulate that these viruses are a very likely candidate hence the specific choice of words in the title of the article. The only thing missing to prove the newly discovered agents are the cause would be by executing Koch's Postulate. As reactive as the herp world is I am not surprised that the authors did not set out to do that, they did the next best thing however with their work on cultured cells.

    The viruses described in the article are a new clade of a family of viruses that, until now, has only been found in mammals, primarily, but not exclusively, rodents. Think of it as basically being a newly discovered species related to a know species. It is never really a surprise when a new species is discovered, it is only a surprise when one is discovered somewhere no one bothered to look on the assumption that there was nothing there. And that last is exactly what happened here, it was assumed that these types of viruses only occurred in mammals so no one ever bothered looking for them anywhere else. the great thing about science is that it is self-correcting. So, in addition to finding a new clade of viruses we have also corrected a mistaken assumption that this type of virus can only be found in mammals.

    It is extremely unlikely that the specific viruses discovered and described in the article are transmitted or even able to be carried by rodents (or humans for that matter). Viruses are very host-specific and do not often jump species and those viruses that do jump are most often between self-similar animals. So the potential for a virus that is specific to the unique cellular biochemistry found in a reptile to jump into a mammalian host is on the none side of a slim to none chance. If you have even a basic comprehension of cladistics then the the phylogeny trees in the article will further support the unlikelihood. If you do not understand phylogeny trees then think of it like this: starting with yourself, go backwards on your own family tree eight generations and then climb back up by an entirely different path. You and the person you come back to are technically "family" but your are about as related to them as you are to me. It is that same degree of "family" that GGV and CASV have with the known mammalian viruses in this family. So put to rest any ideas that animals are getting IBD from bad feeder rodents.


    My biggest suggestion is that people who are interested read the actual article at the link that was posted. If you have questions about it, ask someone who knows what they are talking about. Not some wanker like Skip who quite obviously has an axe to grind
    Looks like someone didn't read my link and has a hard time with concept of sarcasm. Or maybe you couldn't grasp that I was raking his Majesty the Boaphile over the coals for his incredibly backwards and self centered reasons for being an IBD denier. My entire post was so over the top sarcastic and inane that I figured that only the most idiotic of idiots would take it seriously...........

    Congratulations, you just illustrated to the entire community what a humorless twit you are - and that your reading comprehension level is diddly over squat. Next time pull your head out of your rectum before you post.

    It's obvious if any axes need to be ground around here, your thick skull would make an excellent sharpener. Any credibility you have bucko, just dissapeared. People are laughing their butts off that you took that post seriously.

    Hope that helps,

    Skip

    - - - Updated - - -

    Quote Originally Posted by Skiploder View Post
    This cannot be true!

    I have it on the bestest of authorities that IBD DOES NOT EXIST!

    All of the people who have been devastated by it or lost beloved pets by it have been fooled by some vast conspiracy.

    Don't believe me? Well maybe you will believe the utmost authority on all things boa:

    http://www.pethobbyist.com/articles/...tJeffRonne.htm

    Scroll down to:

    roxydementia: what do you think the future holds for IBD research? i have had 2 suspec boas (did not know where to send them back then to be sure) but no one else in the collection was infected its been years. i now run an informal rescue and keep new ones out at least 6 months, but that limits me on space big time, any experiance or advice for me? (any interest in donating cages to a rescue LOL)
    rzaology: ?

    boaphile: It is a really long story... but I do not believe IBD exists. I need to write this up along with all my many many years of anecdotal evedence garnered from tons of people who had been told differently. I can't expalin it all now that is for sure. GA



    and:

    http://www.kingsnake.com/chat/jeff_ronne.html

    RonB- IBD, your thoughts?
    TheBoaphile - I don't believe in it. Long story.
    TheBoaphile - Too long to explain here. I need to write something up on it...
    TheBoaphile - The IBD wackos are moving away from their once long held, bordering on religeous, belief about it now...


    See, all you IBD "whackos" have been misled. THERE IS NO IBD!

    So sorry ER12, IBD exists in the same magical land as the Tooth Fairy, the Easter Bunny, Santa Claus and OJ Simpson's innocence! You have been suckered in by the conspiracy. One of these days the Boaphile will come around with his comprehensive write up including all of his evidence and put this sad farce to bed once and for all.

    Elliott Jacobson and his program at UF will be unmasked for the money laundering operation that funds the sheep sex trade in Kazakhstan. And Buchmeir will be exposed as the Kris Kardashian of the Microbiology and Epidemiology community - selling his soul for fame. Wait and see! Wait and see!
    Bumping this to the top.

    Re-read it very carefully Asplundii.............do you see the sarcasm? Do you see how over the top it is?

    Do you get it now or do I have to take you line by line through it?
    Last edited by Skiploder; 08-16-2012 at 06:34 PM.

  9. #38
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1
    Oh boy.

    It has now come to my attention that several people are discussing this thread and took my post seriously. I do over the top sarcasm and subtle sarcasm. This one was no where close to subtle. I am frankly amazed anyone would have taken it seriously. In an effort to unknot some panties...............:

    Here's some background on my dealings with IBD:

    http://ball-pythons.net/forums/showt...ight=inclusion

    and one of my previous jabs at the Boaphile for his past (present?) stance on IBD (go to the last post):

    http://ball-pythons.net/forums/showt...=1#post1871965
    Last edited by Skiploder; 08-16-2012 at 07:09 PM.

  10. The Following 2 Users Say Thank You to Skiploder For This Useful Post:

    Foschi Exotic Serpents (08-17-2012)

  11. #39
    BPnet Royalty OhhWatALoser's Avatar
    Join Date
    07-28-2007
    Location
    Suburbs of Detroit
    Posts
    4,986
    Thanks
    530
    Thanked 2,721 Times in 1,477 Posts
    Images: 2

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by Skiploder View Post
    My entire post was so over the top sarcastic and inane that I figured that only the most idiotic of idiots would take it seriously...........
    guess ill fall under that group then, I dont understand why on earth you would bring, what is now understood as random misinformation out of basically no where. Was it just "someone said IBD, I must bring this up!". So you took the time to post it so there must of been some sort of point..... then the link you post could easily tie into your sarcasm when you are thinking it does, hence my confusion on the 2nd post. Skip being over the top with his words.... yes im going to see that as sarcasm, he is normally such a dull character.
    Last edited by OhhWatALoser; 08-16-2012 at 07:25 PM.

  12. #40
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: IBD possibly caused by newly discovered rodent virus!

    Quote Originally Posted by OhhWatALoser View Post
    guess ill fall under that group then, I dont understand why on earth you would bring, what is now understood as random misinformation out of basically no where. Was it just "someone said IBD, I must bring this up!". So you took the time to post it so there must of been some sort of point..... then the link you post could easily tie into your sarcasm when you are thinking it does, hence my confusion on the 2nd post. Skip being over the top with his words.... yes im going to see that as sarcasm, he is normally such a dull character.
    Tell you what, OWAL, let me explain why I always reference back to the Boaphile quotes. Maybe then it will put this whole thing into context. Then again, maybe it won't..........

    A number of years ago I had to deal with IBD. It was chronicled here and on some other forums. How it occurred (in two long term animals) and what we went through in terms of testing, emotions, money stress etc.(including things I learned that were contrary to the common wisdom at the time) were openly shared.

    At the time, there was a real fear in the snake community that it could jump to colubrids, and while my collection of boas was very small, my group of colubrids and antaresia and aspidites encompassed some animals that are fairly rare in the States and whose history with me goes back almost 30 years.

    I made a conscious effort to share everything that I was learning and guess what? I took a drubbing for it.

    Many people in the boa community sent me PMs and emails accusing me of fear mongering and more people than I could have ever imagined claimed that IBD did not exist. The proof that was cited? Well, the number one reference was Ronne's quotes.

    Now whether Jeff still denies the existence of IBD or not - I don't know and could care less. The fact is that he did and that the fact that he was considered by some the final say in all things boa was constantly used against me. Why do I still bring it up? Well, OWAL, some of those people who used those quotes against me (and posts he has made on other forums) still post on this forum today. It's my way of needling them back for the BS they tried to fling at me. In fact, in some cases, I am careful to use their very words.......

    I'll go ahead and drop my knife and hold out my hand to Travis or anyone else I've snapped at in this thread. IBD is deadly serious to me. I had to euthanize long term animals I cared about and had to sacrifice more for testing. I spent a long stretch of time in constant dread of walking into the snake house and more importantly, my faith in this community plummeted. I saw people who were more concerned that by me sharing my experiences, that it would hurt their bottom line. When I heard from the IBD researchers that the boa community was literally not supporting their research, I decided that I was done with boids and the subset of hypocritical jackasses who seemed to be their voice at the time.

    There are people in this business that I will not spend a penny on because of their stance on this issue. I have made it a point to not support deniers. I also give annually to IBD research and have repeatedly encouraged people to support the work of Dr. Jacobson and others.

    If anyone wishes to discuss this further, you can PM me. That includes anyone else who has been cross linked to this thread on other forums.
    Last edited by Skiploder; 08-16-2012 at 08:56 PM.

Page 4 of 6 FirstFirst 123456 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1