Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 655

0 members and 655 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,909
Threads: 249,108
Posts: 2,572,140
Top Poster: JLC (31,651)
Welcome to our newest member, KoreyBuchanan
Results 1 to 7 of 7

Threaded View

  1. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Egg eating snakes

    I have 1.1 Dasypeltis scabra, have had them for about 2 years.

    I whole heartedly agree with Dr. Del's advice. Find a local food source before you get one of these animals. If you cannot find a local source then you wil need to syringe feed them which is pretty tramatic on them. Plus, the skeleton on these guys is super, super fragile and they are prone to spinal kinking if handled too roughly. I do not recommend getting baby egg eaters because of this because finding a reliable source of finch eggs is nearly impossible. Get an adult and get your hands on quail eggs and you are all set.

    I wil also say that these guys are a lot more arboreal than the literature suggests so whatever you are housing them in give them lots of room to climb (and consider putting in a couple finch nests as they seem to like to hid out in those.)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Creeptastic (12-22-2009),Kritters4Keeps (12-11-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1