Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,720

0 members and 1,720 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,066
Threads: 249,217
Posts: 2,572,776
Top Poster: JLC (31,651)
Welcome to our newest member, Eric elwell
Results 1 to 7 of 7
  1. #1
    Registered User Creeptastic's Avatar
    Join Date
    04-13-2009
    Location
    Pennsylvania
    Posts
    288
    Thanks
    134
    Thanked 44 Times in 43 Posts

    Egg eating snakes

    My boyfriend is pretty frightened of snakes. We have one ball python, and he does not go near it much. He saw a video the other day of an egg eating snake, and fell in love. Ive been reading up on them, and they seem pretty darn easy to care for. Was wondering if anyone has any experience with them, or knows a good place to purchase one?

  2. #2
    BPnet Veteran
    Join Date
    06-06-2009
    Posts
    731
    Thanks
    77
    Thanked 49 Times in 46 Posts
    Images: 19

    Re: Egg eating snakes

    Ive never had one, but ive seen them on TV and they are so cool! Hope you get one!

  3. The Following User Says Thank You to bamf64 For This Useful Post:

    Creeptastic (12-22-2009)

  4. #3
    in evinco persecutus dr del's Avatar
    Join Date
    04-20-2006
    Location
    Edinburgh, Scotland
    Posts
    24,527
    Thanks
    9,263
    Thanked 6,788 Times in 4,306 Posts
    Images: 93

    Re: Egg eating snakes

    Hi,

    They do look amazing don't they.

    I would do a lot of heavy research into the local availability of food for them though. I seem to remember their size means the eggs they need are pretty small even as full grown adults.


    dr del
    Derek

    7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.

  5. The Following 2 Users Say Thank You to dr del For This Useful Post:

    Creeptastic (12-22-2009),Kritters4Keeps (12-11-2009)

  6. #4
    BPnet Veteran
    Join Date
    09-20-2008
    Posts
    320
    Thanks
    33
    Thanked 23 Times in 21 Posts

    Re: Egg eating snakes

    I talked with a breeder about this species he had babies that he had to feed by taking a syringe and tube take the egg and put the egg in the syringe then put it down there throat once they get older they can eat quail eggs on their own.
    Reptiles make life tolerable.
    Jeremiah Elleman[FONT="Comic Sans MS"][/FO

  7. #5
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Egg eating snakes

    I have 1.1 Dasypeltis scabra, have had them for about 2 years.

    I whole heartedly agree with Dr. Del's advice. Find a local food source before you get one of these animals. If you cannot find a local source then you wil need to syringe feed them which is pretty tramatic on them. Plus, the skeleton on these guys is super, super fragile and they are prone to spinal kinking if handled too roughly. I do not recommend getting baby egg eaters because of this because finding a reliable source of finch eggs is nearly impossible. Get an adult and get your hands on quail eggs and you are all set.

    I wil also say that these guys are a lot more arboreal than the literature suggests so whatever you are housing them in give them lots of room to climb (and consider putting in a couple finch nests as they seem to like to hid out in those.)
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  8. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Creeptastic (12-22-2009),Kritters4Keeps (12-11-2009)

  9. #6
    BPnet Veteran janeothejungle's Avatar
    Join Date
    11-09-2006
    Location
    Central Cali
    Posts
    1,189
    Thanks
    61
    Thanked 427 Times in 162 Posts
    Images: 34

    Re: Egg eating snakes

    Quote Originally Posted by asplundii View Post
    I have 1.1 Dasypeltis scabra, have had them for about 2 years.

    I whole heartedly agree with Dr. Del's advice. Find a local food source before you get one of these animals. If you cannot find a local source then you wil need to syringe feed them which is pretty tramatic on them. Plus, the skeleton on these guys is super, super fragile and they are prone to spinal kinking if handled too roughly. I do not recommend getting baby egg eaters because of this because finding a reliable source of finch eggs is nearly impossible. Get an adult and get your hands on quail eggs and you are all set.

    I wil also say that these guys are a lot more arboreal than the literature suggests so whatever you are housing them in give them lots of room to climb (and consider putting in a couple finch nests as they seem to like to hid out in those.)
    100% agreed. I would also add that if your only previous experience is with bps, an egg eater is not really a logical next step. Many arboreal colubrids are just (anatomically) more delicate snakes. Lighter bone structures, more unique housing requirements, etc, and of course, the steady food supply. When it's love, it's love, just do your homework and be 100% sure you can provide what it needs. Good luck.

    Cheers,
    Kat

  10. The Following User Says Thank You to janeothejungle For This Useful Post:

    Creeptastic (12-22-2009)

  11. #7
    BPnet Veteran anthonym's Avatar
    Join Date
    11-11-2009
    Location
    Oakland, CA
    Posts
    238
    Thanks
    40
    Thanked 72 Times in 49 Posts
    Images: 2

    Re: Egg eating snakes

    Looks like this guy has a pair for sale that he posted yesterday.

    http://market.kingsnake.com/detail.php?cat=6&de=726509

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1