» Site Navigation
1 members and 795 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,105
Posts: 2,572,111
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: Some Woma's we produced
Hey Rick,
I don't get offended by anything and didn't find anything offensive in any of your posts so no sweat.
-
-
-
-
Registered User
Re: Some Woma's we produced
Hey Rick,
I don't get offended by anything and didn't find anything offensive in any of your posts so no sweat.
__________________
Thanks Matt.
-
-
BPnet Veteran
Re: Some Woma's we produced
 Originally Posted by jsmorphs1
Is it just me, or did the original question not really get answered? Someone posted pictures of a combo morph to try and clarify and all it did was confuse the heck out of me  Does anyone have a picture of a hidden gene woma? Just a hidden gene woma, not a yellowbelly granite hidden gene, or any other combo with a hidden gene. I think that the OP's womas look AWESOME  and when I pick up a woma, that's what I want it to look like.
hidden gene woma
-
The Following 2 Users Say Thank You to The Cleaner For This Useful Post:
jsmorphs2 (08-08-2009),Watever (08-09-2009)
-
Re: Some Woma's we produced
-
-
Re: Some Woma's we produced
 Originally Posted by rjs73
I'm just trying to figure out how you can say it is a possible hidden gene carrier when they look so much different from each other.
I agree how can you sell possible het (for lack of a better word) for anything if they look that different.
 Originally Posted by rjs73
All I was trying to do is to see if anyone knew what to look for in a hidden gene woma without anything else added to it.
The hidden gene is not what gives the Type I is different look. The look of the Type I is just a result of whatever gene is responsible for the morph. I believe that the "hidden" gene in Kevin's founder animal is similar to/the same as the the "hidden" gene in RDRs animals that gives rise to the "Daddy" type animals. This gene is another allele in the BluEL group and is the weakest allele. When present as one copy there is not phenotype but when paired with another BluEL allele (Lesser, Butter, etc) you get a "Daddy" animal. Additionally, homozygous hidden seems to be a silent phenotype (RDR produced on of these in '07). Because the allele is silent when alone there is no way to tell if an animal carries it unless you breed it to another animal carrying a visual BluEL allele. That is when you get the really tweaked pattern/colour animals.
 Originally Posted by hross
did this secondary unkown line of nerd woma produce a fatal pearl when the two lines were mated?
The Pearl is the fatal super form of the Type I. No one seems to know if they Type II has a super form or not. Again, it was taken for granted in the early days that the two morphs were the same so no one felt inclined to try crossing the Type II animals after Kevin's discovery of the Pearl. If no one has tried it in a couple years I may try a Type II cross. I would also like to see a Type I x Type II cross to determine if the genes behind these morphs are at all related.
 Originally Posted by The Cleaner
As far as Kevin selling 'possible' hidden gene animals, that might be something that would have happened in the first few years of breeding them I would guess...but I am just guessing.
I woul dbe inclined to agree with you Matt
In the past I have heard people say that they were sold babies as possible hidden gene animals and not one of them could supply any credible evidence supporting this. Usually it boils down to someone wanting to sell a woma and they tell the buyer that Kevin told them it was a possible hidden gene animal. That makes the animal that much more appealing now doesn't it?
I have seen this happening as well. And most of the pics I have seen in such ads are obvious Type II animals to my eye
I just wanted to post some pics of what I thought were some cool looking woma's.
You did do that and they are very cool looking animals.
 Originally Posted by The Cleaner
He actually sent Travis an e-mail earlier today explaining the woma thing and I think that he (Travis) did a great job explaining it 
Thanks Matt, I try
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 4 Users Say Thank You to asplundii For This Useful Post:
Albey (08-08-2009),jsmorphs2 (08-08-2009),muddoc (08-08-2009),Serpent_Nirvana (08-08-2009)
-
Re: Some Woma's we produced
Hi,
So lets see if I can shoehorn this into my thick skull. 
Type I womas are the ones that produce the soulsucker etc and are also known as hidden gene womas but definately have a super form which fails to thrive?
Type II womas are the ones most people will have in their collections and will not produce the whacky combos but no one yet knows if their super form has the same problem?
Or if the super problem also occurs in a type I x type II combo if they prove compatible?
Are the visual differences between the two thinner/ busier pattern and higher white on the type I's when compared to the cleaner lower white on the type II's?
Or is this simply because I have not seen enough of either to fully judge?
dr del
Derek
7 adult Royals (2.5), 1.0 COS Pastel, 1.0 Enchi, 1.1 Lesser platty Royal python, 1.1 Black pastel Royal python, 0.1 Blue eyed leucistic ( Super lesser), 0.1 Piebald Royal python, 1.0 Sinaloan milk snake 1.0 crested gecko and 1 bad case of ETS. no wife, no surprise.
-
-
Re: Some Woma's we produced
 Originally Posted by asplundii
The hidden gene is not what gives the Type I is different look. The look of the Type I is just a result of whatever gene is responsible for the morph. I believe that the "hidden" gene in Kevin's founder animal is similar to/the same as the the "hidden" gene in RDRs animals that gives rise to the "Daddy" type animals. This gene is another allele in the BluEL group and is the weakest allele. When present as one copy there is not phenotype but when paired with another BluEL allele (Lesser, Butter, etc) you get a "Daddy" animal. Additionally, homozygous hidden seems to be a silent phenotype (RDR produced on of these in '07). Because the allele is silent when alone there is no way to tell if an animal carries it unless you breed it to another animal carrying a visual BluEL allele. That is when you get the really tweaked pattern/colour animals.
The Pearl is the fatal super form of the Type I. No one seems to know if they Type II has a super form or not. Again, it was taken for granted in the early days that the two morphs were the same so no one felt inclined to try crossing the Type II animals after Kevin's discovery of the Pearl. If no one has tried it in a couple years I may try a Type II cross. I would also like to see a Type I x Type II cross to determine if the genes behind these morphs are at all related.
I woul dbe inclined to agree with you Matt
I have seen this happening as well. And most of the pics I have seen in such ads are obvious Type II animals to my eye
You did do that and they are very cool looking animals.
Thanks Matt, I try 
As a brand new owner of a Hidden Gene Woma Yellow Belly (Type I) I thank you for putting all of this information in one place.
-
-
Re: Some Woma's we produced
 Originally Posted by dr del
Type I womas are the ones that produce the soulsucker etc and are also known as hidden gene womas but definately have a super form which fails to thrive?
Close.
The original Type I animal you need to think of as a 2 banger. It has the Type I gene AND carried the "hidden" gene. Now, when Kevin bred his founder animal the "hidden" gene would have 1 in 2 odds of being passed on. Additionally the Type I gene had a 1 in 2 chance of being passed on. So the odds of getting another Type I that also carried the "hidden" gene are 1 in 4. The important message to take home here is that not all Type I animals bred from the founder will necessarily have the "hidden" gene. And, by extension, any Type I subsequently produced from those offspring will not necessarily carry the "hidden" gene.
And yes, the super form of the Type I is lethal (the Pearl)
Type II womas are the ones most people will have in their collections and will not produce the whacky combos but no one yet knows if their super form has the same problem?
This is correct
Or if the super problem also occurs in a type I x type II combo if they prove compatible?
Also correct
Are the visual differences between the two thinner/ busier pattern and higher white on the type I's when compared to the cleaner lower white on the type II's?
Or is this simply because I have not seen enough of either to fully judge?
Like you I have not seen enough to necessarily make ab absolute assessment on this but, generally it looks as if the Type I is less busy than the Type II. The Type II is very Spider like in pattern and colour, they Type I not so much. The Type I seems to have the thinner/busier pattern you noted but I do not know if I would call them high white, just that the pattern on them is trimmed with more white (high white to me means the "calico" type white patterning that Spiders have.)
Again, that is just my assessment so I could be missing a few things. Matt may be able to call it a bit better if I mis-ID some trait.
 Originally Posted by Albey
As a brand new owner of a Hidden Gene Woma Yellow Belly (Type I) I thank you for putting all of this information in one place. 
No worries Albey.
Say, if yours is a male, maybe in a few years (assuming I am still in the ATL) we can talk about trying a Type I x Type II cross
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 2 Users Say Thank You to asplundii For This Useful Post:
dr del (08-09-2009),Serpent_Nirvana (08-09-2009)
-
Re: Some Woma's we produced
 Originally Posted by asplundii
The original Type I animal you need to think of as a 2 banger. It has the Type I gene AND carried the "hidden" gene. Now, when Kevin bred his founder animal the "hidden" gene would have 1 in 2 odds of being passed on. Additionally the Type I gene had a 1 in 2 chance of being passed on. So the odds of getting another Type I that also carried the "hidden" gene are 1 in 4. The important message to take home here is that not all Type I animals bred from the founder will necessarily have the "hidden" gene. And, by extension, any Type I subsequently produced from those offspring will not necessarily carry the "hidden" gene.
... So then there should also, theoretically, be some normal BPs out there with the silent "hidden" gene that was originally carried by the Type I double-carrier, correct?
Does that gene still have the same effect by itself, or is the Type I gene also necessary for the neat combos such as the soul-sucker? Is the soul-sucker a triple-combo (Type I x hidden gene x lesser), or just a double (hidden gene x lesser)?
Thanks for posting all of this info; this is clearing up a huge amount of mystery for me regarding the hidden gene "womas" ...
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|