Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,827

1 members and 1,826 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 76,049
Threads: 249,210
Posts: 2,572,712
Top Poster: JLC (31,651)
Welcome to our newest member, Mikvik
Page 3 of 3 FirstFirst 123
Results 21 to 24 of 24
  1. #21
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What are the Genetics for a Superstripe Ball Python?

    Quote Originally Posted by nixer View Post
    i think someone tried that, but didnt get anything.
    Not that that is necessarily definitive when you consider the 3 in 4 chance of NOT hitting anything...

    I think the best way to determine if Spector/Whirlwind have a super form would be to put 2 Superstripes together. Possible offspring would be Ivory, Superstripe and whatever the super form of Spector/Whirlwind might be.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. #22
    BPnet Veteran nixer's Avatar
    Join Date
    03-28-2007
    Location
    indiana
    Posts
    2,827
    Thanks
    339
    Thanked 329 Times in 294 Posts
    Images: 3

    Re: What are the Genetics for a Superstripe Ball Python?

    Quote Originally Posted by asplundii View Post
    Not that that is necessarily definitive when you consider the 3 in 4 chance of NOT hitting anything...

    I think the best way to determine if Spector/Whirlwind have a super form would be to put 2 Superstripes together. Possible offspring would be Ivory, Superstripe and whatever the super form of Spector/Whirlwind might be.
    actually that wouldnt work either because both animals would carry both genes so that would not tell you if its a super form.

  3. #23
    BPnet Veteran nixer's Avatar
    Join Date
    03-28-2007
    Location
    indiana
    Posts
    2,827
    Thanks
    339
    Thanked 329 Times in 294 Posts
    Images: 3

    Re: What are the Genetics for a Superstripe Ball Python?

    Quote Originally Posted by Albey View Post
    Yea it is the same one. I should get four clutches from him, that one, two more regular Yellow Belly’s, and one from a Pastel.
    man thats sweet! mine stopped eating just shy of what i would breed but next year it should be plenty big.

  4. #24
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: What are the Genetics for a Superstripe Ball Python?

    Quote Originally Posted by nixer View Post
    actually that wouldnt work either because both animals would carry both genes so that would not tell you if its a super form.
    Not sure I follow.

    Spector/Whirlwind/YB are allelic. If you breed a SuperStripe to a SuperStripe you are breeding SpectorYB to a SpectorYB so your possible outcomes of offspring are YBYB (i.e SuperYB aka Ivory) SpectorYB (i.e. SuperStripe) and SpectorSpector (i.e. SuperSpector)

    So... If you did the cross and some "new" phenotype showed up you would know it to be the SuperSpector.

    If no "new" phenotype showed up I would hold all the SuperStripe offspring for later investigation and try the cross again at least one more time under the assumption I missed the SuperSpector (1 in 4 odds are not sure things after all). If still no "new" phenotype showed up I would take the SuperStripe offspring and breed them to Ivories. If the SuperSpector is visually the same as a SuperStripe (SpectorYB) then breeding a SuperSpector to an Ivory will yield all SuperStripes (SpectorYB). Where as breeding a SuperStripe (SpectorYB) to an Ivory would yield SuperStripes (SpectorYB) and Ivories.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

Page 3 of 3 FirstFirst 123

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1