Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,833

1 members and 1,832 guests
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,098
Threads: 249,242
Posts: 2,572,928
Top Poster: JLC (31,651)
Welcome to our newest member, nightfallvt
Page 2 of 8 FirstFirst 12345678 LastLast
Results 11 to 20 of 73
  1. #11
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by strikerratt View Post
    that's just Ignorance at it's best to say that i for one am sick of people Bashing big snake owners and now some of the reptile community is turning it's back on us..... just remember this after the government bans our pets your pets will be next and not just reptiles but dog's cat's and small pets too
    I have re-read all the posts in this thread and can't see where anyone bashed big snakes.

    The government is in OUR hobby because people in this hobby have acted ignorantly, irresponsibly and arrogantly.

    It seems that even USARK and PIJAC, the defenders of reptile hobbyist's rights, are realizing that idiots in this community have just about ruined it for the rest of us.

    That's why you see them assisting in passing legislation in North Carolina, in Florida and other places.

    While I don't support all of the verbiage in some of legislation that USARK has helped to pass, I at least see the wisdom in their approach - show the government and the people that the reptile hobby is willing and able to show restraint and act responsibly - something that the former owners of those burms, varanids and iguanas in Florida did not do.

    As for the government banning our dogs and cats - where's your proof?

    100,000 burms in the Everglades? Disgusting. Instead of pouting about the bill we should all step back and think about how THIS hobby is assisting in the deterioration of an amazing ecosystem.

    Reptile people calling in and being rude? We urinate on the carpet and then whine and stomp our feet when someone slaps a diaper on us. Pathetic.

    USARK and HSUS agreeing to the amendment? What do you make of that?

  2. The Following User Says Thank You to Skiploder For This Useful Post:

    DutchHerp (07-30-2009)

  3. #12
    BPnet Veteran Adam_Wysocki's Avatar
    Join Date
    09-26-2004
    Location
    Bel Air, MD
    Posts
    9,027
    Thanks
    58
    Thanked 1,029 Times in 195 Posts
    Images: 1

    Re: I Attended the HR2811 Hearing on July 29th

    Representative Wasserman Schultz from Florida was the only vote to oppose the amendment. Her position is that all pythons should be banned. If you live in her district, you might want to educate yourself about when she's up for re-election and decide what you'd like to do with that information.

    It's also worth noting that Humane Society of the United States (HSUS) CEO Wayne Pacelle was present for the beginning of the hearing. He was accompanied by Michael Markarian who is the president of the HSUS Legislative Fund (the branch of the HSUS that lobbys in Congress) as well as other members of the HSUS executive staff. These are the leaders of the most powerful and wealthiest animals rights organization in the world. It is no coincidence that they were at the markup meeting today ... they want the reptile industry gone ... and they're willing to do it one species at a time if they have to (obviously). For whatever it's worth, Wayne Pacelle called people who own exotic animals (like pythons) "foolish" in his blog a couple weeks ago and declared that exotic animal owners have no idea how to properly take care of their pets.

    Please join USARK ... please join PIJAC ... please donate to either or both organizations ... even if it's only $1 ... please do anything and everything that you reasonably can to protect your rights. Even if you don't keep burms or african rock pythons, your pet of choice will probably be on the chopping block sooner or later. Send a message NOW that we as animal owners won't stand for it ... ever!

    -adam
    Click Below to Fight The National Python & Boa Ban




    "The world is a dangerous place, not because of those who do evil, but because of those who look on and do nothing."
    - Anna Sewell, author of Black Beauty


  4. The Following 15 Users Say Thank You to Adam_Wysocki For This Useful Post:

    + Show/Hide list of the thanked

    Ben_Renick (07-31-2009),bsd13 (07-30-2009),ColinWeaver (07-30-2009),GregBennett (07-31-2009),icygirl (07-30-2009),jsmorphs2 (07-30-2009),Kara (07-31-2009),kenneally1 (07-31-2009),Louis Kirkland (07-30-2009),MarkS (07-30-2009),Mendel's Balls (07-30-2009),Muze (07-30-2009),neilgolli (07-30-2009),retic720 (08-01-2009),snakemastercanada (07-31-2009)

  5. #13
    BPnet Veteran DutchHerp's Avatar
    Join Date
    05-10-2008
    Location
    Texas
    Posts
    2,315
    Thanks
    605
    Thanked 410 Times in 298 Posts
    Images: 6

    Re: I Attended the HR2811 Hearing on July 29th

    Skippie gets it
    MH

    Who the hell is Pat?

    "Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes

  6. #14
    BPnet Lifer Skiploder's Avatar
    Join Date
    03-03-2007
    Location
    Under a pile of wood.
    Posts
    3,580
    Thanks
    113
    Thanked 3,727 Times in 1,257 Posts
    Images: 1

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by Adam_Wysocki View Post
    Representative Wasserman Schultz from Florida was the only vote to oppose the amendment. Her position is that all pythons should be banned. If you live in her district, you might want to educate yourself about when she's up for re-election and decide what you'd like to do with that information.

    It's also worth noting that Humane Society of the United States (HSUS) CEO Wayne Pacelle was present for the beginning of the hearing. He was accompanied by Michael Markarian who is the president of the HSUS Legislative Fund (the branch of the HSUS that lobbys in Congress) as well as other members of the HSUS executive staff. These are the leaders of the most powerful and wealthiest animals rights organization in the world. It is no coincidence that they were at the markup meeting today ... they want the reptile industry gone ... and they're willing to do it one species at a time if they have to (obviously). For whatever it's worth, Wayne Pacelle called people who own exotic animals (like pythons) "foolish" in his blog a couple weeks ago and declared that exotic animal owners have no idea how to properly take care of their pets.

    Please join USARK ... please join PIJAC ... please donate to either or both organizations ... even if it's only $1 ... please do anything and everything that you reasonably can to protect your rights. Even if you don't keep burms or african rock pythons, your pet of choice will probably be on the chopping block sooner or later. Send a message NOW that we as animal owners won't stand for it ... ever!

    -adam
    I am not a fan of HSUS or that idiot Pacelle. I read his blog entry and could not find where he said that exotic animal owners had no idea how to properly take care of their pets - or was that not in the blog?

    I also thought that he states that it was foolish to keep lions, chimps and burmese pythons as pets. For the record, I agree with 66% of that statement.

    Going back to his statement (whether written or otherwise) regarding exotic animal owners not being able to properly care for their pets - even a blind pig gets an occasional acorn.

    There are alot of dedicated and excellent reptile keepers - there are also a fair amount of people who buy reptiles with no idea how to care for them. We see it on the forums all the time - don't we? Some are lucky enough to come here and get advice from some very patient people that puts them on the right track before they kill or sicken their animals, but an untold number do not.

    While someone seeking a ball-python morph may not fit into that category, I've seen an awful lot of young, inexperienced people getting into retics, burms and anacondas.

    So while Pacelle is a jacka$$, his statement could easily be amended to be essentially correct - MANY exotic animal owners have no idea how to properly take care of their pets.

    A couple of weeks ago it was debated here that the legislation passed in North Carolina was unfair and restrictive. While parts of the wording could be open to interpretation with respect to enforcement, I could not - for the life of me - understand why a responsible snake owner would have issue with being required to properly cage, transport or transfer ownership of venomous or giant snakes. I'd say we were just about split on support of the concept of the bill.

    How do you feel about people's efforts to thwart sensible legislation backed by people in THIS hobby?

  7. The Following User Says Thank You to Skiploder For This Useful Post:

    The Vampire Osiris (08-01-2009)

  8. #15
    BPnet Veteran DutchHerp's Avatar
    Join Date
    05-10-2008
    Location
    Texas
    Posts
    2,315
    Thanks
    605
    Thanked 410 Times in 298 Posts
    Images: 6

    Re: I Attended the HR2811 Hearing on July 29th

    One thing really bugs me... the "Reptile Nation" won't take responsiblity for what they've done.

    Take the Barkers, for instance.

    They stay there are no records of people releasing burmese pythons in the wild of Florida. Like the bastard that does will report himself, right?

    Then, they try to blame it on a) hurricanes blowing down zoos and b) imported babies - yay, affecting even MORE ecosystems! - escaping from airports.

    C'mon, people.

    These snakes were released by irresponsible buttholes of reptile owners.

    They are competing with the native wildlife - which is already having a tough time with all the other thousands of imported species - to survive in THEIR NATIVE HABITAT.

    But hey, according to the Barkers, it cannot be said they'll have a negative impact on the Everglades!

    Can you people do simple math? Burmese pythons eat food... food that native species would eat... add these two together, and you'll figure out in a short time - well, unless you're not very bright - that native species will have an even harder time finding food.

    The burms are there to stay. Banning pythons won't stop that.

    It will, however, prevent other burmese/african rock/whatever pythons from populating yet another area.

    Instead of saving our right to keep these animals in cages, the Reptile Nation should fight for natural ecosystems and preserve them.

    Later, Matt
    MH

    Who the hell is Pat?

    "Pattimuss doesn't run, he prances most delicately, like a beautiful but sad fairy, winged and capped, curly toed shoes on each foot, dancing on dewdrops while lazy crickets play soft music for him to keep time by...." - Wes

  9. #16
    BPnet Veteran Adam_Wysocki's Avatar
    Join Date
    09-26-2004
    Location
    Bel Air, MD
    Posts
    9,027
    Thanks
    58
    Thanked 1,029 Times in 195 Posts
    Images: 1

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by Skiploder View Post
    I am not a fan of HSUS or that idiot Pacelle. I read his blog entry and could not find where he said that exotic animal owners had no idea how to properly take care of their pets - or was that not in the blog?

    I also thought that he states that it was foolish to keep lions, chimps and burmese pythons as pets. For the record, I agree with 66% of that statement.

    Going back to his statement (whether written or otherwise) regarding exotic animal owners not being able to properly care for their pets - even a blind pig gets an occasional acorn.

    There are alot of dedicated and excellent reptile keepers - there are also a fair amount of people who buy reptiles with no idea how to care for them. We see it on the forums all the time - don't we? Some are lucky enough to come here and get advice from some very patient people that puts them on the right track before they kill or sicken their animals, but an untold number do not.

    While someone seeking a ball-python morph may not fit into that category, I've seen an awful lot of young, inexperienced people getting into retics, burms and anacondas.

    So while Pacelle is a jacka$$, his statement could easily be amended to be essentially correct - MANY exotic animal owners have no idea how to properly take care of their pets.

    A couple of weeks ago it was debated here that the legislation passed in North Carolina was unfair and restrictive. While parts of the wording could be open to interpretation with respect to enforcement, I could not - for the life of me - understand why a responsible snake owner would have issue with being required to properly cage, transport or transfer ownership of venomous or giant snakes. I'd say we were just about split on support of the concept of the bill.

    How do you feel about people's efforts to thwart sensible legislation backed by people in THIS hobby?
    Here is a blog post that I wrote about HSUS's position on exotic (aka non-native) animals as pets. http://nohr669.com/blog/?p=321

    As far as your question goes, I feel that people have the right to question and/or criticize anything that makes them uncomfortable. I don't believe in taking anything at face value. By questioning, debating, even criticizing legislation and proposed legislation whether introduced by the anti-pet movement or by our pro-pet advocates, we can only move forward in a positive direction. Silence and blind acceptance are the precursors to the death of democracy.

    -adam
    Click Below to Fight The National Python & Boa Ban




    "The world is a dangerous place, not because of those who do evil, but because of those who look on and do nothing."
    - Anna Sewell, author of Black Beauty


  10. The Following 5 Users Say Thank You to Adam_Wysocki For This Useful Post:

    ColinWeaver (07-30-2009),dsirkle (07-30-2009),Muze (07-30-2009),neilgolli (07-30-2009),sweety314 (07-30-2009)

  11. #17
    BPnet Veteran Adam_Wysocki's Avatar
    Join Date
    09-26-2004
    Location
    Bel Air, MD
    Posts
    9,027
    Thanks
    58
    Thanked 1,029 Times in 195 Posts
    Images: 1

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by DutchHerp View Post
    One thing really bugs me... the "Reptile Nation" won't take responsiblity for what they've done.

    Take the Barkers, for instance.

    They stay there are no records of people releasing burmese pythons in the wild of Florida. Like the bastard that does will report himself, right?

    Then, they try to blame it on a) hurricanes blowing down zoos and b) imported babies - yay, affecting even MORE ecosystems! - escaping from airports.

    C'mon, people.

    These snakes were released by irresponsible buttholes of reptile owners.

    They are competing with the native wildlife - which is already having a tough time with all the other thousands of imported species - to survive in THEIR NATIVE HABITAT.

    But hey, according to the Barkers, it cannot be said they'll have a negative impact on the Everglades!

    Can you people do simple math? Burmese pythons eat food... food that native species would eat... add these two together, and you'll figure out in a short time - well, unless you're not very bright - that native species will have an even harder time finding food.

    The burms are there to stay. Banning pythons won't stop that.

    It will, however, prevent other burmese/african rock/whatever pythons from populating yet another area.

    Instead of saving our right to keep these animals in cages, the Reptile Nation should fight for natural ecosystems and preserve them.

    Later, Matt
    If you're so convinced that pet owners are responsible for burms in the everglades and that HR2811 will prevent them from "populating yet another area" ... I have one simple question for you.

    Why is it that there only seems to be a problem with burmese pythons in Florida?

    Is there something special about Florida burmese owners that compels them to release their snakes into the environment and yet burmese python owners in the other 47 continental US states are able to restrain themselves?

    If this was just a simple problem of snakes being released by pet owners and other areas are able to support burmese pythons like you suggest, wouldn't the same problem seen in the Everglades exist in those other areas already?

    Florida is the only state with a feral population of burmese ... according to your statements, there should be other states with the same problem but there are none.

    Personally, I don't see any definitive evidence one way or the other (hopefully I'm entitled to my own opinions), but I do find it hard to believe that Florida is the only state where burmese python owners let their animals go into the environment. I can't help but wonder why other states that supposedly can support wild populations of burms don't already have a problem?

    -adam
    Click Below to Fight The National Python & Boa Ban




    "The world is a dangerous place, not because of those who do evil, but because of those who look on and do nothing."
    - Anna Sewell, author of Black Beauty


  12. The Following 7 Users Say Thank You to Adam_Wysocki For This Useful Post:

    Alice (07-31-2009),Ben_Renick (07-31-2009),Clear (07-30-2009),kenneally1 (07-31-2009),Muze (07-30-2009),rabernet (07-30-2009),The Vampire Osiris (08-01-2009)

  13. #18
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by DutchHerp View Post
    I think large constrictors should be banned in Florida and Georgia, at least.
    ...

    Quote Originally Posted by DutchHerp View Post
    Oh, please, don't call me ignorant. Remember, the situation in the Everglades is due to IGNORANT snake owners.
    Ummm... Let's see... The Everglades are in Florida and are some 500 miles or so from Georgia. And the climate in Georgia (even S. Georgia) is not amicable to Burms. And yet you are calling for their ban in Georgia.


    Yep, I think ignorant about sums it up.

    Quote Originally Posted by Russ Lawson View Post
    Do yourself a favor and read this before making accusations like that.
    http://vpi.com/sites/vpi.com/files/O...compressed.pdf
    That is a good one Russ. I also like this one:

    Claims of potential expansion throughout the U.S. by invasive python species are contradicted by ecological niche models by Pyron et al.

    http://www.pubmedcentral.nih.gov/art...medid=18698351

    Plus, it was published in a peer reviewed journal. Give it a bit more credibility. (Not that I do not think the Barkers are credible, they are. But the population at large is hesitant to "believe" unless it is published in a real journal.)

    Quote Originally Posted by DutchHerp View Post
    What's your point? I think it's a good idea to ban these pythons in Florida.
    His point is that you need to educate your self on the facts of the matter before running your mouth off. If you want to think it is okay to ban these animals in Florida and Georgia then you better have a good reason why and right now your "good" reason is nothing more than the propaganda that HSUS and Bill Nelson are spouting.

    If the Barkers are right, then imported hatchlings "escaped" into Florida...
    Dear god are you serious?? An unforeseen and unpredictable act of nature is the most likely cause of the population in the 'Glades. Holding facilities, zoos, road side menageries and homes were destroyed by that act of nature and from some of these a few Burms were unfortunately released. There is no way of knowing if they were imported hatchlings or long term captives or 4th generation adults from captive breedings.

    so stop the importation of hatchlings to Florida, and new populations can be prevented.
    Because everyone knows that if another act of nature were to roll through Florida and obliterate homes and collections that someones captive bred animal would be totally incapable of breeding should it be inadvertently freed...

    Quote Originally Posted by Adam_Wysocki View Post
    If you're so convinced that pet owners are responsible for burms in the everglades and that HR2811 will prevent them from "populating yet another area" ... I have one simple question for you.

    Why is it that there only seems to be a problem with burmese pythons in Florida?
    Adam raises a good question but I have a (to me at least) better one. Where do you get off dictating what ought to be legal/illegal in someone elses state when you yourself knowing, willingly and publicly violate the laws of your own state?
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  14. The Following 2 Users Say Thank You to asplundii For This Useful Post:

    Muze (07-30-2009),Russ Lawson (07-30-2009)

  15. #19
    BPnet Lifer wolfy-hound's Avatar
    Join Date
    10-10-2005
    Location
    Florida
    Posts
    5,505
    Thanks
    2,128
    Thanked 2,221 Times in 1,151 Posts
    Images: 23

    Re: I Attended the HR2811 Hearing on July 29th

    Quote Originally Posted by DutchHerp View Post
    They stay there are no records of people releasing burmese pythons in the wild of Florida. Like the bastard that does will report himself, right?

    Then, they try to blame it on a) hurricanes blowing down zoos and b) imported babies - yay, affecting even MORE ecosystems! - escaping from airports.

    C'mon, people.

    These snakes were released by irresponsible buttholes of reptile owners.

    Later, Matt

    You seriously believe that people too irresponsible to keep or give away the giant snake suddenly develop a NEED to drive all the way down to the Everglades to release them? REALLY? Suddenly there's this stream of burm owners all driving across the country to the Everglades at the TIP of florida, just to turn that snake loose? Or do you seriously believe that only people near the Everglades own burms?

    Yes I think the burms in the everglades are a issue, but pet owners didn't release them there. You can look at time-lines of hurricanes and where they hit, and how much damage and when burmese started appearing.

    Also you can detail how banning everyone else's pets will somehow make the burms in the Everglades disappear? If that's true, we should take away YOUR car, because it will make all the drunk drivers stop hitting people.
    Theresa Baker
    No Legs and More
    Florida, USA
    "Stop being a wimpy monkey,; bare some teeth, steal some food and fling poo with the alphas. "

  16. The Following 4 Users Say Thank You to wolfy-hound For This Useful Post:

    Alice (07-31-2009),GregBennett (07-31-2009),Muze (07-30-2009),sweety314 (07-30-2009)

  17. #20
    BPnet Veteran nixer's Avatar
    Join Date
    03-28-2007
    Location
    indiana
    Posts
    2,827
    Thanks
    339
    Thanked 329 Times in 294 Posts
    Images: 3

    Re: I Attended the HR2811 Hearing on July 29th

    i highly suggest to everyone they start boycotting businesses that donate to the hsus and peta. ive done so quite some time ago. and dont hesitate to ask your local petshops if they donate to them before purchasing items. so far ive got one local petstore to stop all donations to hsus.

  18. The Following User Says Thank You to nixer For This Useful Post:

    GregBennett (07-31-2009)

Page 2 of 8 FirstFirst 12345678 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1