Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 582

1 members and 581 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,117
Posts: 2,572,190
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 20

Threaded View

  1. #15
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: High Contrast Albino Question

    Wallace,

    I think we are actually saying the same thing just in different terms. I never used the phrase "hyper melanistic" so I am not sure where that entered into the equation... In my original post I said you wanted to breed to animals with 1) a dark black background and 2) high gold "aliens". I am guessing that you thought I meant hyper melanistic when I was talking about the dark black background?? That is not the case though, I was just saying to use "high contrast" normals which would have a marked difference between background and alien. I also believe that the red/brown flush in the background colour of the animal is from xanthins so if you use an animal that is more black than it is red you are less likely to get the "dirty" yellow spots popping up in the white areas of an albino.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    littleindiangirl (07-21-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1