Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 604

0 members and 604 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
Welcome to our newest member, KBFalconer
Page 2 of 2 FirstFirst 12
Results 11 to 20 of 20
  1. #11
    BPnet Veteran Bill Buchman's Avatar
    Join Date
    12-30-2007
    Location
    So Cal
    Posts
    957
    Thanks
    324
    Thanked 287 Times in 206 Posts
    Images: 80

    Re: Napalm -- 2nd Gene Discovered???

    Quote Originally Posted by West Coast Jungle View Post
    That guy is hot, fill me in on the napalm?
    Congrats Bill, looks like you have a real exciting season going

    Raul -- Below is part of a post from earlier in the season. It was up to date -- until Mr. Napalm Granite showed up. I have only had 3 clutches from him and will will need to get some more before I can have ANY educated/informed position what my Napalm boy is holding genetically.

    Below are Napalm founding male and his Napalm Pastel son hatched in 08.







    Napalm background:

    I got him in the spring of 2007 -- all 65 grams of him.


    Eric Davies (Fire founder) has seen him(Napalm) and has no doubt he will make a Black Eyed Leucy when bred back to his daughters. He also thinks their might be a second gene at work as well -- he thought an Axanthic or Granite type gene. Eric was very gracious and excited about the project. He gave me complete support to name it my line of Fire.

    After some thought , I decided that I would be consistent with naming and follow what I did with my Cajun. While the Cajun has some similarity to Het Reds, Joe Compel's Brown Back, and BHB's Lori Ball -- it is not directly related and has differences -- and will likely make a somewhat different super.

    I have a Davies line Fire male that has been breeding up a storm this season. Between the Napalm, Napalm Pastel, and Fire -- I should have more than enough girls to hold back. Maybe will let go of a few as well. It will be a few years before they will be breedable to prove the Napalm Super and find out if the Napalm will be compatible with the Fire -- my best guess is that they will be. But as they say -- you've got to breed it to know for sure. I could look into picking up a sub adult/adult Fire female this year to speed the process up a bit.

    The breeding I am doing the season with both males will begin to show what is going on with him.

    Both animals are SHOCKINGLY BRIGHT after a shed. There are some other pics in my photo albums -- including some belly shots of the Napalm.

    Exciting project for me I must say. I am fortunate that they are both breeding well this season. I'll post pics, babies, and info as the project unfolds.

    I am not a big proponent in secrets and partial truths with projects -- and I am not withholding any facts about the animals or their breedings. I just don't know "everything" -- YET. It will take some time to hatch some clutches to see what is going on with the project. Thanks ever so much for the kind/supportive responses.
    Bill Buchman

  2. The Following User Says Thank You to Bill Buchman For This Useful Post:

    TheOtherLeadingBrand (07-13-2009)

  3. #12
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Napalm -- 2nd Gene Discovered???

    Hey Bill,

    That odd looking one looks a bit like the PaintBall to me...
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  4. #13
    BPnet Veteran Bill Buchman's Avatar
    Join Date
    12-30-2007
    Location
    So Cal
    Posts
    957
    Thanks
    324
    Thanked 287 Times in 206 Posts
    Images: 80

    Re: Napalm -- 2nd Gene Discovered???

    Quote Originally Posted by asplundii View Post
    Hey Bill,

    That odd looking one looks a bit like the PaintBall to me...
    I think you mean Super Paint --which is the visual of the somewhat normal looking Paint. I don't think it is a SuperPaint. It does not have the "concentrated scales" and the pattern is wrong. Plus, Super Paint is a homozygous animal. By the way, I LOVE the Super Paint!!!!

    The Napalm and CH mom are unrelated and certainly not similar animals. Therefore, a homo visual would be impossible from this breeding.
    Bill Buchman

  5. #14
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Napalm -- 2nd Gene Discovered???

    Quote Originally Posted by Bill Buchman View Post
    I think you mean Super Paint
    Yes, typed too fast this morning

    The Napalm and CH mom are unrelated and certainly not similar animals. Therefore, a homo visual would be impossible from this breeding.
    I was not saying necessarily that your odd ball was a SuperPaint, just that they look to be related/similar. And, as we know well with BPs, genetics can be a weird thing. I would not think it impossible that your Napalm and your CH are "hets" for a less extreme allele of "Paint", one that has no visual but which can create a SuperPaint-like homozygous visual... But then again, maybe it is something totally new and unrelated.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. The Following User Says Thank You to asplundii For This Useful Post:

    Bill Buchman (07-13-2009)

  7. #15
    BPnet Royalty ballpythonluvr's Avatar
    Join Date
    11-23-2008
    Location
    Pennsylvania
    Posts
    8,062
    Thanks
    4,207
    Thanked 3,152 Times in 2,887 Posts
    Images: 6

    Re: Napalm -- 2nd Gene Discovered???

    Just incredible!

  8. The Following User Says Thank You to ballpythonluvr For This Useful Post:

    Bill Buchman (07-13-2009)

  9. #16
    BPnet Veteran Bill Buchman's Avatar
    Join Date
    12-30-2007
    Location
    So Cal
    Posts
    957
    Thanks
    324
    Thanked 287 Times in 206 Posts
    Images: 80

    Re: Napalm -- 2nd Gene Discovered???

    Quote Originally Posted by asplundii View Post
    Yes, typed too fast this morning



    I was not saying necessarily that your odd ball was a SuperPaint, just that they look to be related/similar. And, as we know well with BPs, genetics can be a weird thing. I would not think it impossible that your Napalm and your CH are "hets" for a less extreme allele of "Paint", one that has no visual but which can create a SuperPaint-like homozygous visual... But then again, maybe it is something totally new and unrelated.
    I here what you are saying for sure. I appreciate any/all opinions and other sets of eyes looking at these guys!!

    It could be that the reduced/less extreme female is a 2 gene animal Napalm + mom gene -- and the Granite type might be a 3 gener -- 2 from Napalm and 1 from mom. I have no idea.

    I am fortunate in that the extreme guy is a male. I like my chances for growing him up and breeding him to some stuff next season in order to find out what"s up????
    Bill Buchman

  10. #17
    BPnet Veteran Jason Bowden's Avatar
    Join Date
    04-28-2009
    Location
    Broussard, LA
    Posts
    2,081
    Thanks
    1,156
    Thanked 576 Times in 550 Posts

    Re: Napalm -- 2nd Gene Discovered???

    Awesome! Keep those beauties coming Bill!!!

  11. The Following User Says Thank You to Jason Bowden For This Useful Post:

    Bill Buchman (07-13-2009)

  12. #18
    BPnet Royalty SlitherinSisters's Avatar
    Join Date
    06-26-2008
    Location
    SE Iowa
    Posts
    14,644
    Thanks
    2,135
    Thanked 4,381 Times in 3,885 Posts
    Blog Entries
    4
    Images: 70

    Re: Napalm -- 2nd Gene Discovered???

    WOW!!! He's neat!

  13. The Following User Says Thank You to SlitherinSisters For This Useful Post:

    Bill Buchman (07-13-2009)

  14. #19
    BPnet Lifer muddoc's Avatar
    Join Date
    03-23-2006
    Location
    Louisiana
    Posts
    5,340
    Thanks
    1,202
    Thanked 1,606 Times in 618 Posts
    Images: 49

    Re: Napalm -- 2nd Gene Discovered???

    Congrats Bill. That is a very unique looking animal. I wouldn't mind looking at that in my tub everyday. I can't wait to see you figure out this stuff a bit more.
    Tim Bailey
    (A.K.A. MBM or Art Pimp)
    www.baileyreptiles.com
    The Blog

  15. The Following User Says Thank You to muddoc For This Useful Post:

    Bill Buchman (07-13-2009)

  16. #20
    BPnet Veteran TheOtherLeadingBrand's Avatar
    Join Date
    10-16-2008
    Location
    Florida
    Posts
    926
    Thanks
    884
    Thanked 182 Times in 166 Posts

    Re: Napalm -- 2nd Gene Discovered???

    wow!!! I want to see that in pastel! that is awesome!

  17. The Following User Says Thank You to TheOtherLeadingBrand For This Useful Post:

    Bill Buchman (07-13-2009)

Page 2 of 2 FirstFirst 12

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1