Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 746

2 members and 744 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,915
Threads: 249,118
Posts: 2,572,199
Top Poster: JLC (31,651)
Welcome to our newest member, KBFalconer
Results 1 to 10 of 20

Threaded View

  1. #13
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Napalm -- 2nd Gene Discovered???

    Quote Originally Posted by Bill Buchman View Post
    I think you mean Super Paint
    Yes, typed too fast this morning

    The Napalm and CH mom are unrelated and certainly not similar animals. Therefore, a homo visual would be impossible from this breeding.
    I was not saying necessarily that your odd ball was a SuperPaint, just that they look to be related/similar. And, as we know well with BPs, genetics can be a weird thing. I would not think it impossible that your Napalm and your CH are "hets" for a less extreme allele of "Paint", one that has no visual but which can create a SuperPaint-like homozygous visual... But then again, maybe it is something totally new and unrelated.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Bill Buchman (07-13-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1