» Site Navigation
0 members and 583 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,915
Threads: 249,118
Posts: 2,572,196
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: Napalm -- 2nd Gene Discovered???
-
The Following User Says Thank You to Bill Buchman For This Useful Post:
-
Re: Napalm -- 2nd Gene Discovered???
Hey Bill,
That odd looking one looks a bit like the PaintBall to me...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Napalm -- 2nd Gene Discovered???
-
-
Re: Napalm -- 2nd Gene Discovered???
 Originally Posted by Bill Buchman
I think you mean Super Paint 
Yes, typed too fast this morning 
The Napalm and CH mom are unrelated and certainly not similar animals. Therefore, a homo visual would be impossible from this breeding.
I was not saying necessarily that your odd ball was a SuperPaint, just that they look to be related/similar. And, as we know well with BPs, genetics can be a weird thing. I would not think it impossible that your Napalm and your CH are "hets" for a less extreme allele of "Paint", one that has no visual but which can create a SuperPaint-like homozygous visual... But then again, maybe it is something totally new and unrelated.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Bill Buchman (07-13-2009)
-
Re: Napalm -- 2nd Gene Discovered???
-
The Following User Says Thank You to ballpythonluvr For This Useful Post:
Bill Buchman (07-13-2009)
-
BPnet Veteran
Re: Napalm -- 2nd Gene Discovered???
 Originally Posted by asplundii
Yes, typed too fast this morning
I was not saying necessarily that your odd ball was a SuperPaint, just that they look to be related/similar. And, as we know well with BPs, genetics can be a weird thing. I would not think it impossible that your Napalm and your CH are "hets" for a less extreme allele of "Paint", one that has no visual but which can create a SuperPaint-like homozygous visual... But then again, maybe it is something totally new and unrelated.
I here what you are saying for sure. I appreciate any/all opinions and other sets of eyes looking at these guys!!
It could be that the reduced/less extreme female is a 2 gene animal Napalm + mom gene -- and the Granite type might be a 3 gener -- 2 from Napalm and 1 from mom. I have no idea.
I am fortunate in that the extreme guy is a male. I like my chances for growing him up and breeding him to some stuff next season in order to find out what"s up????
-
-
Re: Napalm -- 2nd Gene Discovered???
Awesome! Keep those beauties coming Bill!!!
-
The Following User Says Thank You to Jason Bowden For This Useful Post:
Bill Buchman (07-13-2009)
-
Re: Napalm -- 2nd Gene Discovered???
-
The Following User Says Thank You to SlitherinSisters For This Useful Post:
Bill Buchman (07-13-2009)
-
Re: Napalm -- 2nd Gene Discovered???
Congrats Bill. That is a very unique looking animal. I wouldn't mind looking at that in my tub everyday. I can't wait to see you figure out this stuff a bit more.
-
The Following User Says Thank You to muddoc For This Useful Post:
Bill Buchman (07-13-2009)
-
BPnet Veteran
Re: Napalm -- 2nd Gene Discovered???
wow!!! I want to see that in pastel! that is awesome!
-
The Following User Says Thank You to TheOtherLeadingBrand For This Useful Post:
Bill Buchman (07-13-2009)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|