» Site Navigation
2 members and 596 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,189
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
Mystery Caramel clutch-updated pics
Well, everyone has shed and fed, so I thought you all might be interested in seeing these updated shots. First, a caramel albino, then a really light, blushing caramel that I can't quite convince myself is a Pastel Caramel, then a post-shed shot of the pastel that hatched out of this clutch.
So, any further opinions?


Brad Chambers
Texans-Join Herp Conservation Unlimited-or don't complain!
WWW.HCU-TX.ORG
-
-
BPnet Veteran
Re: Mystery Caramel clutch-updated pics
Brad, Id say they are both caramels with the second being a very nice one
-
The Following User Says Thank You to FIREball For This Useful Post:
-
BPnet Veteran
Re: Mystery Caramel clutch-updated pics
Ummm..
Isn't an albino specifically have the pink eye characteristic, I don't see that in the caramel albino...
Just wondering
-
-
Registered User
Re: Mystery Caramel clutch-updated pics
Caramel albinos are not standard albinos-they do show some color in the eye. Their mutation is on a different gene loci than the more common albino, which is more properly called "amelanistic, actually...
Brad Chambers
Texans-Join Herp Conservation Unlimited-or don't complain!
WWW.HCU-TX.ORG
-
-
Re: Mystery Caramel clutch-updated pics
I really like that second one. He's smokin!!
-
The Following User Says Thank You to twistedtails For This Useful Post:
-
Re: Mystery Caramel clutch-updated pics
"Standard Albinos" are actually Tyrosinase Negative Amelanistic. Isn't that a mouthful? Caramel albinos are Tyrosinase Positive Amelanistic.
Amelanistic means lacking in the pigment melanin. Melanin is a black pigment. Tyrosinase causes the brown coloration, and Xanthin is the yellow coloration. So far, all axanthic animals (lacking yellow) are also tyrosinase positive, though some probably are tyrosinase-reduced.
-
-
Re: Mystery Caramel clutch-updated pics
Here is one of my trade mark crazy theories:
Was dad from a clutch with some pastels (or even just a pastel possible parent)? Maybe dad is a chimera and even though he doesn't look pastel part of him is a pastel sibling and he can throw some pastel sperm? I'm very interested in how the paradox animals breed as they might be chimeras where the skin is split between dissimilar siblings. Maybe your male is a chimera where only the reproductive organs (or maybe other internals) are split even though the skin is consistently not pastel.
And continuing with the X Files; do we really know for sure that amelanistic is T negative and not compatible with caramel? Has anyone tested either?
-
-
Re: Mystery Caramel clutch-updated pics
 Originally Posted by WingedWolfPsion
"Standard Albinos" are actually Tyrosinase Negative Amelanistic. Isn't that a mouthful? Caramel albinos are Tyrosinase Positive Amelanistic.
Caramel albinos are not amelanistic. They still produce melanin, just at a much reduced level. That is why they still have a bit of brown colour to them 
 Originally Posted by RandyRemington
Here is one of my trade mark crazy theories:
Was dad from a clutch with some pastels (or even just a pastel possible parent)? Maybe dad is a chimera and even though he doesn't look pastel part of him is a pastel sibling and he can throw some pastel sperm? I'm very interested in how the paradox animals breed as they might be chimeras where the skin is split between dissimilar siblings. Maybe your male is a chimera where only the reproductive organs (or maybe other internals) are split even though the skin is consistently not pastel.
I like your crazy theory Randy. I have had the same gut feeling about paradox type animals. I have never seen/heard of a purely internal chimera but there is nothing to say it is not possible...
And continuing with the X Files; do we really know for sure that amelanistic is T negative and not compatible with caramel? Has anyone tested either?
Have not heard of anyone crossing the two if that is what you are asking... One of these days I may get bored enough to generate some test primers and throw them against my normal and albino... Could be an interesting little experiment...
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|