Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 617

1 members and 616 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,117
Posts: 2,572,189
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Page 4 of 4 FirstFirst 1234
Results 31 to 40 of 40
  1. #31
    BPnet Veteran
    Join Date
    09-14-2007
    Location
    Northern Virginia
    Posts
    3,250
    Thanks
    170
    Thanked 703 Times in 538 Posts

    Re: Do all morphs have diffrent personalities?

    Quote Originally Posted by Spaniard View Post
    I am however happy that this spurred the discussion it did since I think some good information was shared.
    x2! This has been a great discussion!
    Casey

  2. The Following User Says Thank You to kc261 For This Useful Post:

    scutechute (06-22-2009)

  3. #32
    House Snakes Addict... Aes_Sidhe's Avatar
    Join Date
    06-12-2009
    Location
    New York
    Posts
    3,813
    Thanks
    1,851
    Thanked 1,065 Times in 848 Posts
    Images: 5

    Re: Do all morphs have diffrent personalities?

    Damm what a mind storm... LOL
    You know i just think that if some people say that every spider wobble you can say that every ball wobble a liitle bit. Dont You think so ??


    CLICK HERE to LIKE The RLReptiles on FACEBOOK

    Rafal Lisinski

    1.0 Striped African House Snake "Marduk"
    0.1 Striped African House Snake Ishtar
    1.0 black phase Brown House Snake Seth
    0.1 black phase Brown House Snake Nephthys



  4. #33
    BPnet Veteran Serpent_Nirvana's Avatar
    Join Date
    06-15-2009
    Location
    New England
    Posts
    842
    Thanks
    357
    Thanked 303 Times in 216 Posts

    Re: Do all morphs have diffrent personalities?

    Quote Originally Posted by Freakie_frog View Post
    Really?? very cool I did not know that..I wonder what effect if any that repaired DNA would have on the animal?
    In theory, repaired DNA should have no effect as it should be just that -- repaired, fixed, same as normal

    If the repair fails, the cell cycle should abort and the cell should be destroyed. If this fails, that's when you get mutation ...

    It IS possible to have an "insertion mutation," in which you have extra base pairs inserted into the middle of a gene, or a deletion, in which case base pairs are deleted. However, I still don't see how another mutated gene could somehow "fix" that mutation, unless the mutation was recessive and the mutated gene just happened to miraculously code for the same protein as is defective in the first mutation. ... Just don't see that happening with the spider/neuro mutations.

    That's very interesting that there are phenotypically normal spider sibs that show neuro signs -- definitely puts up a "plus one" to the linkage theory in my book ...

  5. #34
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Do all morphs have diffrent personalities?

    Quote Originally Posted by Freakie_frog View Post
    Really?? very cool I did not know that..I wonder what effect if any that repaired DNA would have on the animal?
    Quote Originally Posted by Serpent_Nirvana View Post
    In theory, repaired DNA should have no effect as it should be just that -- repaired, fixed, same as normal
    Serpent beat me to it but he is correct. Repaired DNA should be no different from what it looked like before. There are some cases where the repair system glitches and you get a point mutation. However, for DNA damage to happens in every cell at the exact same place at the exact same time would be an almost impossible occurrence and to have all those damaged areas mis-repaired in the exact same way would be bordering on the near to infinitely impossible... So, the only way one of these mismatch point mutations is going to become obvious is if it occurs in a gamete and is later passed on. In most cases this is not going to make an obvious change but in some cases it may be the cause of a spontaneous mutation.

    Quote Originally Posted by Spaniard View Post
    So I've gone back and looked up some threads in hopes that I would find the mention of combos showing less wobbles. I know I've read it numerous times and was trying to see who the source was just out of my own curiousity. I couldn't find anything (figures) but I know I didn't pull the information out of the air.
    I never thought you pulled this idea out of thin air I have heard this rumor tossed around a few times. I think it is just something that is bound to happen when you are discussing a topic as volatile as the "wobble" in spiders. Like I said in an earlier post, the "wobble" is a stigma in this morph. In reality it probably should not be and if it had not been kept a "secret" in the early days then it probably would not have been. I think the best thing for the hobby in general would be to just embrace the fact that "wobble" goes with spider. If everyone just accepted it then there would not be a need for rumors to pop up around it.

    I know when I'm wrong and for the record I would like to retract this statement made above...

    I agree with asplundii saying it was too much of a blanket statement. I am however happy that this spurred the discussion it did since I think some good information was shared.
    I was not trying to beat you down and I apologize if I came off that way. Sometimes I get a little overzealous.

    Quote Originally Posted by kc261 View Post
    x2! This has been a great discussion!
    You will not get any argument from me. It has been a great discussion and I have enjoyed it
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  6. #35
    BPnet Veteran Spaniard's Avatar
    Join Date
    08-02-2006
    Location
    Farmingdale, Long Island
    Posts
    4,405
    Thanks
    355
    Thanked 580 Times in 487 Posts
    Images: 2

    Re: Do all morphs have diffrent personalities?

    No problem, a beat down here and there never hurt anybody
    ~*Rich
    1.0 100% Het Albino
    1.3 Normal
    1.0 Spider
    0.1 Mojave
    1.0 Pastel 100% Het Goldfinger
    0.1 Pastel 66% Het Goldfinger
    0.1 Pastel PH Goldfinger


  7. #36
    Registered User
    Join Date
    10-01-2008
    Posts
    39
    Thanks
    0
    Thanked 0 Times in 0 Posts

    Re: Do all morphs have diffrent personalities?

    i heard somewhere that spiders have quite a voracious feeding response, mine has never missed a feed since i got it as a baby, (apart from breeding)

  8. #37
    BPnet Veteran Serpent_Nirvana's Avatar
    Join Date
    06-15-2009
    Location
    New England
    Posts
    842
    Thanks
    357
    Thanked 303 Times in 216 Posts

    Re: Do all morphs have diffrent personalities?

    My male spider ate like a blood python. My female seems to want live but I'm hoping I can convert her over ...

    I'm curious, though -- I had thought that the OP was asking if individual morphs have different personalities (as in, spiders are friendly, albinos are jerks, etc) ... Has anyone noticed this to be the case? I have heard that pieds tend to be terrible eaters, but that's about the only "personality" type association I've heard of.

    (I know of course all of that is total hearsay, no scientific basis whatsoever, but I am curious as to what trends other morph owners may have noticed...)

  9. #38
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Do all morphs have diffrent personalities?

    When I got my woma I asked the breedier if the morph had any quirks and he said that like spiders they were vicious eaters.

    I have heard the rumor that pied could be difficult.

    Beyond those and the already mentioned caramels and supper cinny/black pastels I have not heard of any morph quirks
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  10. #39
    BPnet Veteran Spaniard's Avatar
    Join Date
    08-02-2006
    Location
    Farmingdale, Long Island
    Posts
    4,405
    Thanks
    355
    Thanked 580 Times in 487 Posts
    Images: 2

    Re: Do all morphs have diffrent personalities?

    The breeder I got my mojave from said BHB told him all his mojaves are great eaters. I only own one but she never turns down a meal. I think she would stuff herself to the rim if I let her.
    ~*Rich
    1.0 100% Het Albino
    1.3 Normal
    1.0 Spider
    0.1 Mojave
    1.0 Pastel 100% Het Goldfinger
    0.1 Pastel 66% Het Goldfinger
    0.1 Pastel PH Goldfinger


  11. #40
    BPnet Veteran th3jok3r's Avatar
    Join Date
    05-15-2009
    Location
    Newburgh, NY
    Posts
    277
    Thanks
    35
    Thanked 21 Times in 21 Posts

    Re: Do all morphs have diffrent personalities?

    all of you have been amazing with information!! I am glad i started this thread it has beeen so helpful filled with great responses i thought i was going to get a simple answer but instead i got more information than my brain can digest!! i find myself reading it over and over to make sense of it all. I dont like the thought that out there in the wild or someones dinker project can form another gorgeous python with some type of neurological disorder or any disorder for that fact that might be sever to the point the ball python cant survive we might run into it we might not but you never know again thanks for all the great input guys! i have alot of + rep to give out lol

Page 4 of 4 FirstFirst 1234

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1