» Site Navigation
0 members and 568 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,912
Threads: 249,117
Posts: 2,572,189
Top Poster: JLC (31,651)
Welcome to our newest member, coda
|
-
Registered User
Woma hidden gene
Do all womas have the hidden gene or only nerds line???
-
-
Re: Woma hidden gene
NERD has two woma lines they work with, one has the hidden gene and the other does not.
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
BPnet Veteran
Re: Woma hidden gene
There is actually only 1 line of woma, it is believed that the origional woma was bred to a special female and those babies are the ones with the "special" gene.
Womas on their own do not have the special gene, and the ones with the gene seem to look pretty normal as the gene is a suttle one.
-
-
Re: Woma hidden gene
 Originally Posted by jnjreptiles
There is actually only 1 line of woma, it is believed that the origional woma was bred to a special female and those babies are the ones with the "special" gene.
Womas on their own do not have the special gene, and the ones with the gene seem to look pretty normal as the gene is a suttle one.
Hmmm if its a combo and you can't tell a hidden gene from a regular woma wonder how they can sell them with all certainty that it carries the gene..
Hidden gene's intrigue me to no end
When you've got 10,000 people trying to do the same thing, why would you want to be number 10,001? ~ Mark Cuban "for the discerning collector"
-
-
Re: Woma hidden gene
 Originally Posted by jnjreptiles
There is actually only 1 line of woma, it is believed that the origional woma was bred to a special female and those babies are the ones with the "special" gene.
Womas on their own do not have the special gene, and the ones with the gene seem to look pretty normal as the gene is a suttle one.
When questioned on Reptile Radio about the inferno Keven went on to talk about the hidden woma gene. He was the one who stated they have two lines...so I dunno 
Not doubting your statement but just wanted to put out there where I got my information from.
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
Registered User
Re: Woma hidden gene
so all the combos are made from gene or any reg woma will do , meaning the the lesser woma
-
-
Re: Woma hidden gene
 Originally Posted by Spaniard
NERD has two woma lines they work with, one has the hidden gene and the other does not.
 Originally Posted by jnjreptiles
There is actually only 1 line of woma, it is believed that the origional woma was bred to a special female and those babies are the ones with the "special" gene.
I would guess you are both correct, but the word "line" is rather ambiguous.
As is evidenced in these 2 posts, it can refer to everything descended from the original morph, or it could also refer to a much smaller subset.
The best example of this that I know of is in corn snakes. Abbott's okeetees are very well known, and I don't think anyone would dispute that they deserve to be considered a separate line. However, I've heard that most if not all of Lee Abbott's founding stock was selected from the Love line of okeetees. Okeetee itself is just a line of normals that came from a region that tended to have more brightly colored snakes. So that's 3 different lines (of normals!) that all originated from the same group of WCs.
I have also wondered about how they know if any one particular woma carries the hidden gene. Even if it descended from the hidden gene line, that doesn't guarantee it has the gene. There must be subtle visible differences, but so far I've never heard what those are.
-
-
Re: Woma hidden gene
 Originally Posted by ang3l3s
so all the combos are made from gene or any reg woma will do , meaning the the lesser woma
Some womas have the hidden gene. Some don't. There isn't a ton of information about the hidden gene out there yet, only time and crossing out hidden gene womas will tell.
Hidden gene womas when paired with lessers can make "soul suckers".
Non hidden-gene womas when paired with lessers can only make lesser-womas, which look very different than soul suckers, but are very beautiful in their own right.
-
-
Registered User
Re: Woma hidden gene
agreed.. but a woma lesser pastel comes close dont' u think
-
-
Re: Woma hidden gene
 Originally Posted by kc261
I have also wondered about how they know if any one particular woma carries the hidden gene. Even if it descended from the hidden gene line, that doesn't guarantee it has the gene. There must be subtle visible differences, but so far I've never heard what those are.
IIRC, from the same RR mentioned above, Kevin notes that the hidden gene womas do have a subtle "marker" trait to them but he does not really say what it is.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|