» Site Navigation
0 members and 2,127 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,067
Threads: 249,217
Posts: 2,572,782
Top Poster: JLC (31,651)
|
-
the only dumb question.....
is the one you don't ask!!
why do they call it axanthic and not anery when talking about ball pythons?
-
-
Re: the only dumb question.....
Because ball pythons have the yellow xanthophores and not the red/orange erythrophores
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: the only dumb question.....
 Originally Posted by asplundii
Because ball pythons have the yellow xanthophores and not the red/orange erythrophores 
Hey, Doc...long time. Do you think its possible that pteridine pigments and carotinoids, because they can be found in the same organelle, may both be present in ball pythons but at much differing concentrations so that the red/orange is masked by an abundance of xanthin (and melanin)? I'm just wondering where the reddish brown hues come from. Because the pigments (pteridine and carotine) are found together in organelles of many species of snake, might a gene that knocks out xanthism also knock out erythrism? And if erythrophores are in small supply, would their visual detection be almost negligible? Just speculation, but I know that you could provide some insight on this.
-
The Following User Says Thank You to GenePirate For This Useful Post:
-
BPnet Veteran
Re: the only dumb question.....
that made my head hurt,,,,answer in short,,,thats just how it,,because they said so,,,,
1.0 blonde pastel,1.8 normal,1.1 het orange ghost 1.0 het butterscotch 0.1 het green ghost 0.1 het albino 0.1 rtb 0.1 yellow anaconda 1.0 borneo blood 1.0 albino burmese
-
-
BPnet Veteran
Re: the only dumb question.....
 Originally Posted by Lucas339
is the one you don't ask!!
why do they call it axanthic and not anery when talking about ball pythons?
This is an excellent question. Glad you asked. I don't think the answer is as easy as it seems.
 Originally Posted by RebelYell83
that made my head hurt,,,,answer in short,,,thats just how it,,because they said so,,,,
Sorry, Rebel, didn't mean to kill your Friday. This is a topic that I started working on with Greg Graziani a year or so ago, but I dropped the ball because I got overwhelmed in trying to find contract electron microscopy laboratories that didn't charge a "caramel glow" for a couple of pics. Actually, its not THAT expensive, but still beyond my budget right now.
-
The Following User Says Thank You to GenePirate For This Useful Post:
-
Re: the only dumb question.....
Hey Pirate,
I do not see any reason that both pigments could not be present in the chromatophore, like you noted, it is not at all uncommon that chromatophores contains more than one type of pigment, it is just that there is usually a significant abundance in one pigment type so it is the only one you see.
As far as BPs in specific all I can do is speculate. Without an complete BP genome or a detailed enzymology scan we really can not say anything with any certainty. So, bearing in mind that I am doing nothing more than speculating, the reddish hue in BPs could indeed be in part due to the presence of carotenoids in the chromatophores. I would guess there probably are carotenoids in the xanthophores and I would venture to say that the "high contrast" albinos have a higher concentration of carotenoids in the xanthophores than "low contrast" animals have. There may be carotenoids in the melanophores but it is also possible that the reddish hue is just an artifact of their melanin/melanophores and has no relation to carotenoids (I am inclined to think this more likely as the T- albinos show no trace of red blushing on the areas that lack xanthophores.)
I do not think axanthism would necessarily knock out the "erythrism". Been a long time since I have done any reading on chromatophores but IIRC pigment mutations do not tend to disrupt the chromatophore, instead they disrupt the pigment production. So I believe that even in axanthic animals the xanthophore is actually present, it is just that the pteridine pigments are not being produced/transported to the chromatophore. And since the chromatophore is still there then there should still be a place for carotenoids to be housed.
I'll bend my brain on this more over the weekend and see if I can come up with any more ideas.
And I'd love to hear more about what you and Greg were working at/on
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following 3 Users Say Thank You to asplundii For This Useful Post:
kc261 (06-12-2009),Lucas339 (06-12-2009),Tikall (06-15-2009)
-
Re: the only dumb question.....
 Originally Posted by asplundii
Hey Pirate,
I do not see any reason that both pigments could not be present in the chromatophore, like you noted, it is not at all uncommon that chromatophores contains more than one type of pigment, it is just that there is usually a significant abundance in one pigment type so it is the only one you see.
As far as BPs in specific all I can do is speculate. Without an complete BP genome or a detailed enzymology scan we really can not say anything with any certainty. So, bearing in mind that I am doing nothing more than speculating, the reddish hue in BPs could indeed be in part due to the presence of carotenoids in the chromatophores. I would guess there probably are carotenoids in the xanthophores and I would venture to say that the "high contrast" albinos have a higher concentration of carotenoids in the xanthophores than "low contrast" animals have. There may be carotenoids in the melanophores but it is also possible that the reddish hue is just an artifact of their melanin/melanophores and has no relation to carotenoids (I am inclined to think this more likely as the T- albinos show no trace of red blushing on the areas that lack xanthophores.)
I do not think axanthism would necessarily knock out the "erythrism". Been a long time since I have done any reading on chromatophores but IIRC pigment mutations do not tend to disrupt the chromatophore, instead they disrupt the pigment production. So I believe that even in axanthic animals the xanthophore is actually present, it is just that the pteridine pigments are not being produced/transported to the chromatophore. And since the chromatophore is still there then there should still be a place for carotenoids to be housed.
I'll bend my brain on this more over the weekend and see if I can come up with any more ideas.
And I'd love to hear more about what you and Greg were working at/on
That was clear as mud but it does cover the ground However I'm so glad there are people out there researching our industry. This can only be good for all of us. By the way you already bent my brain
-
-
BPnet Veteran
Re: the only dumb question.....
 Originally Posted by asplundii
Hey Pirate,
I do not see any reason that both pigments could not be present in the chromatophore, like you noted, it is not at all uncommon that chromatophores contains more than one type of pigment, it is just that there is usually a significant abundance in one pigment type so it is the only one you see.
As far as BPs in specific all I can do is speculate. Without an complete BP genome or a detailed enzymology scan we really can not say anything with any certainty. So, bearing in mind that I am doing nothing more than speculating, the reddish hue in BPs could indeed be in part due to the presence of carotenoids in the chromatophores. I would guess there probably are carotenoids in the xanthophores and I would venture to say that the "high contrast" albinos have a higher concentration of carotenoids in the xanthophores than "low contrast" animals have. There may be carotenoids in the melanophores but it is also possible that the reddish hue is just an artifact of their melanin/melanophores and has no relation to carotenoids (I am inclined to think this more likely as the T- albinos show no trace of red blushing on the areas that lack xanthophores.)
I do not think axanthism would necessarily knock out the "erythrism". Been a long time since I have done any reading on chromatophores but IIRC pigment mutations do not tend to disrupt the chromatophore, instead they disrupt the pigment production. So I believe that even in axanthic animals the xanthophore is actually present, it is just that the pteridine pigments are not being produced/transported to the chromatophore. And since the chromatophore is still there then there should still be a place for carotenoids to be housed.
I'll bend my brain on this more over the weekend and see if I can come up with any more ideas.
And I'd love to hear more about what you and Greg were working at/on
Knew I could count on you. I'll think more about what you said this weekend, too, and get back with you.
-
The Following User Says Thank You to GenePirate For This Useful Post:
-
Re: the only dumb question.....
Wow I need to break out my VPI book and re-read that Skin and Color section...my head-o-phores are going to explode!
~*Rich
1.0 100% Het Albino
1.3 Normal
1.0 Spider
0.1 Mojave
1.0 Pastel 100% Het Goldfinger
0.1 Pastel 66% Het Goldfinger
0.1 Pastel PH Goldfinger

-
-
Re: the only dumb question.....
I can't quite follow all of what gene pirate and asplundii are talking about, but I will say it sure is refreshing to see a thread that goes a lot deeper than "if I pair my het pied with my pastel, will I get pastel pieds?"
Thanks guys!
-
The Following 3 Users Say Thank You to kc261 For This Useful Post:
asplundii (06-15-2009),GenePirate (06-12-2009),scutechute (06-15-2009)
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|