Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 1,871

0 members and 1,871 guests
No Members online
Most users ever online was 54,199, 06-29-2026 at 02:43 AM.

» Today's Birthdays

None

» Stats

Members: 76,104
Threads: 249,252
Posts: 2,572,975
Top Poster: JLC (31,651)
Welcome to our newest member, GarlandFbj
Results 1 to 9 of 9

Thread: Albino & Pastel

Threaded View

  1. #9
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Albino & Pastel

    Quote Originally Posted by cinderbird View Post

    If you breed the offspring together (pastel het albino x pastel het albino) you can get: super pastel albinos, super pastels 66% het albino, pastels 66% het albino, and normals 66% het albino.
    You could also get pastel albinos and normal albinos from a sib x sib breeding
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    BPMIKE (05-19-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1