» Site Navigation
0 members and 853 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,905
Threads: 249,104
Posts: 2,572,103
Top Poster: JLC (31,651)
|
-
Registered User
Albino & Pastel
When you breed these two will you get a % of albinos pastels and pastel Albinos or will you get all Pastel Albinos?
Thanks.Mike.
-
-
Re: Albino & Pastel
You wouldnt get albino pastels/pastel albinos at all since albinism is a recessive gene and pastel is co dominant. You would get about
50% normal appearing offspring -100% Het for albino
50% Pastel - 100% Het for albino
0.1 GHI Mojave
0.1 Super special h scaleless
0.1 Desert ghost
1.0 WC Dinker
-
The Following User Says Thank You to Meltdown Morphs For This Useful Post:
-
Registered User
Re: Albino & Pastel
 Originally Posted by kyote19
You wouldnt get albino pastels/pastel albinos at all since albinism is a recessive gene and pastel is co dominant. You would get about
50% normal appearing offspring -100% Het for albino
50% Pastel - 100% Het for albino
Thank You.Iam still working on figuring out the genetics but not having much luck.
Mike.
-
-
Re: Albino & Pastel
 Originally Posted by BPMIKE
Thank You.Iam still working on figuring out the genetics but not having much luck.
Mike.
This will help you understand the basics
http://www.ballpython.ca/what_get/dominant.html
http://www.ballpython.ca/what_get/co_dominant.html#
http://www.ballpython.ca/what_get/recessive.html
As for the Pastel Albino it represent a few years of work invested in a project that is not very different from a regular Albino http://www.ralphdavisreptiles.com/ma...ino_pastel.asp
-
The Following User Says Thank You to Stewart_Reptiles For This Useful Post:
-
BPnet Veteran
Re: Albino & Pastel
If you have an albino and a pastel het for albino you would get albinos, pastel albinos, pastel hets, and just hets right? Well you have a chance of these odds whether it works out that way who knows.
-
The Following User Says Thank You to sg1trogdor For This Useful Post:
-
BPnet Veteran
Re: Albino & Pastel
albino,albino pastel,pastel 100% het albino,100% het albino.......
-
The Following User Says Thank You to hmj75 For This Useful Post:
-
BPnet Veteran
Re: Albino & Pastel
 Originally Posted by hmj75
albino,albino pastel,pastel 100% het albino,100% het albino.......
cool thats what I was thinking.
-
The Following User Says Thank You to sg1trogdor For This Useful Post:
-
Re: Albino & Pastel
 Originally Posted by hmj75
albino,albino pastel,pastel 100% het albino,100% het albino.......
this is not accurate.
Pastel x Albino:
you will get normal appearing offspring 100% het for albino
you will get pastel offspring 100% het for albino
if you breed the pastel het albino back to the original albino parent, you can make albinos, pastel albinos, 100% het albinos and pastels 100% het albinos.
If you breed the offspring together (pastel het albino x pastel het albino) you can get: super pastel albinos, super pastels 66% het albino, pastels 66% het albino, and normals 66% het albino.
-
The Following User Says Thank You to cinderbird For This Useful Post:
-
Re: Albino & Pastel
 Originally Posted by cinderbird
If you breed the offspring together (pastel het albino x pastel het albino) you can get: super pastel albinos, super pastels 66% het albino, pastels 66% het albino, and normals 66% het albino.
You could also get pastel albinos and normal albinos from a sib x sib breeding
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|