» Site Navigation
2 members and 1,074 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 75,916
Threads: 249,118
Posts: 2,572,202
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: Is this a good deal & is it what its supposed to be?
 Originally Posted by btrout56
I ran across someone today at the serpentarium and he has this guy for sale, priced at $150, says its a woma....Also I was wondering if this is a good morph as far as morph combos? What can you produce by these womas? 
The Picture that you have posted does look to be a Woma.
It is a Co-dom morph, so if bred to a normal the odds would be 50% womas and 50% normals for the offspring.
There is a Super (Homozygous) form called the "Pearl" but it appears to be a lethal gene and all the Pearl offspring have failed to live as far as I know. Though I would not let that keep me from getting a woma they do make some nice combos and are beautiful reduced pattern animals even in the plain Heterozyous form!
The link above to NERD does have some good information on the woma's and possible combos.
$150 is a great price for a woma, I personally would purchase a nice woma for that price.
Last edited by JAMills; 05-08-2009 at 07:16 AM.
Reason: addition
-
-
Registered User
Re: Is this a good deal & is it what its supposed to be?
I'm still learning my morphs, but regardless, its a pretty snake
-
-
Re: Is this a good deal & is it what its supposed to be?
buy it!! the combos are really nice!!
-
-
Re: Is this a good deal & is it what its supposed to be?
for $150 I'd be careful, that sounds awful cheap for a woma.
Both of those pictures posted look very nice though.
-
-
Re: Is this a good deal & is it what its supposed to be?
 Originally Posted by stratus_020202
Are you saying lessers look like Womas?
Id get it, Womas make awesome combos.
- Matt
Come here little guy. You're awfully cute and fluffy but unfortunately for you, you're made of meat
-
-
BPnet Veteran
Re: Is this a good deal & is it what its supposed to be?
Holy Schmoles! 150 is a steal for a male Woma that's bout half the market price and it aint bad lookin either
The Matrix is a system, Neo. That system is our enemy. But when you're inside, you look around, what do you see? Businessmen, teachers, lawyers, carpenters. The very minds of the people we are trying to save. But until we do, these people are still a part of that system and that makes them our enemy. You have to understand, most of these people are not ready to be unplugged. And many of them are so inured, so hopelessly dependent on the system, that they will fight to protect it.
-
-
Re: Is this a good deal & is it what its supposed to be?
no offence to anyone involved but something stinks. Don't know why they would be selling it so cheap. If I were you I would shoot the breeder an email and just be upfront and honest with them. Tell them that the price concerns you, and you want to know why they are selling it for less then half of going market price.
Mikey Cavanaugh
(904) 318-3333
-
-
Re: Is this a good deal & is it what its supposed to be?
I am with Mike on this, something just does not sound right about a woma for $150... I would tread carefully
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Is this a good deal & is it what its supposed to be?
True, it could be a problem feeder or be kinked or any number of health problems.
~MIKE~
You:How many snakes do you have?
Me: Oh, just a room full.
You:Eh, how many?
Me:A ROOM FULL.
-
-
Re: Is this a good deal & is it what its supposed to be?
 Originally Posted by Mike Cavanaugh
no offence to anyone involved but something stinks. Don't know why they would be selling it so cheap. If I were you I would shoot the breeder an email and just be upfront and honest with them. Tell them that the price concerns you, and you want to know why they are selling it for less then half of going market price.
it sounds like it is at a store?? not with a breeder. but yes, 150 is cheap and at that price, if it is a woma, its a great deal
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|