» Site Navigation
0 members and 661 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,073
Threads: 249,220
Posts: 2,572,813
Top Poster: JLC (31,651)
|
-
Re: Bel
 Originally Posted by eulenspiegel
Hmm but don't you think housing 2 Lesser Platinum and feeding them for 4 years will amount to the same price as just buying a BEL now?
You need to add in food, electricity, substrate, vet and tank setup.
2 Lesser Plats cost around 1000-1500 bucks together
That is almost half the cost of a BEL
Well, to extend that logic further, you could save the money you'd have spent buying the ingredients of the desired morph, and save the money you'd spend caring for them, and, in a few years, buy want you want outright. However, that would take all the fun out of it, wouldn't it?
I've thought that about a few of my projects, but nothing beats the joy of seeing that lovely morph emerging from an egg, especially after a few years of waiting.
That said, I'd go for buying the nicest female het lucy now, and start looking for a male for her in a year (since the female will take more time to get up to breeding weight/age).
We'll be looking for your BEL pics in the future!
-
-
BPnet Veteran
Re: Bel
 Originally Posted by tenai
let me elaborate before the flames come. in the case of all morphs, they are genetic deformities yes. however when speaking of leucistic animals its an occurrence that takes place when 2 co-doms (incomplete dominant) breed.
because of some animals breeding history some lukes come out cleaner than others (compare mojo/mojo to lesser/lesser pair breedings) this has to do with pedigree and what it took to create this morph in the beginning.
now heres a strange occurrence....take one that makes a dirty (mojo) and one that makes a clean (lesser). pair them up and they come out nearly flawless.
just keep in mind that although the chances are arguably 14% of hatching one.
thats 14% chance PER EGG. not per clutch. that means you have an 86% chance of something else per egg.
Just curious where are you getting 14% chance?
if you are talking about crossing any of the BEL complex morphs they are accepted as being variants of the same gene so you so you only have 4 outcomes from the crossing... normal, morph1, morph2, and BEL. Thus the chance would be 25% per egg. It is the same as if you bred Mojo X Mojo, Lessor X Lessor, Butter X Butter and so on...
Also what part of Jersey are you in? I live on the Jersey Shore.
-
-
BPnet Veteran
Re: Bel
im just curious. does anybody have a pic of what a mojo x lesser looks like?
-
-
BPnet Veteran
Re: Bel
Hey Rocky, if you've been paying attention to the answers to your questions you will realize that the cheapest way to get a clean BEL is Mojave X Lesser.
-Steven
-
-
Re: Bel
 Originally Posted by Freakie_frog
Ok just so everybody knows the first picture is a Karma (Phantom X Lesser) totally different critter all together..
Not really a different creature at all since Phantom is just another of the het BluEL alleles. The super Phantom is just a really dirty BluEL, all things being equal, when compared to a mojo x mojo (dirty BluEL) or one of the other combos (cleaner BluEL). The Phantom x Lesser fall into the "other combo" category
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|