» Site Navigation
1 members and 798 guests
Most users ever online was 9,191, 03-09-2025 at 12:17 PM.
» Today's Birthdays
» Stats
Members: 75,886
Threads: 249,086
Posts: 2,572,036
Top Poster: JLC (31,651)
|
-
BPnet Veteran
Re: leucistic combos
 Originally Posted by Bill Buchman
From what I understand, Black Eyed Leucy's and Blue Eyed will not make a white snake -- both base morphs will present. Fire Butter, Butter Yellow Belly, Fire Yellow Belly etc. 
But what he was saying is that the mojave and butter would combine to make a blue eyed lucy and then it carrying the pastel and yellowbelly part would just be an extra plus to the pairing.
-
The Following User Says Thank You to Fearless For This Useful Post:
Bill Buchman (04-07-2009)
-
BPnet Veteran
Re: leucistic combos
 Originally Posted by Fearless
But what he was saying is that the mojave and butter would combine to make a blue eyed lucy and then it carrying the pastel and yellowbelly part would just be an extra plus to the pairing.
If you hit the the odds on the BEL AND the Yellow Belly gene were also present as a third -- it would not be a "visual Leucy" (white snake only) IMHO.
-
-
BPnet Veteran
Re: leucistic combos
 Originally Posted by t-Roy
Leucistic is the end of any combo right? I mean after a snake is all white, what else can you do?
Leucistics, especially considering to date the fact they're all super forms of co-doms, are more valuable for their breeding potential (ability to throw 100% carrier offspring) than for their potential for more complex Leucistic morphs. Sure the super form costs a little more, but in the long run statistical certainty is worth the initial outlay.
The Earth is the cradle of mankind, but one cannot live in the cradle forever. -Konstantin Tsiolkovsky

-
-
Re: leucistic combos
 Originally Posted by ctrlfreq
Leucistics, especially considering to date the fact they're all super forms of co-doms, are more valuable for their breeding potential (ability to throw 100% carrier offspring) than for their potential for more complex Leucistic morphs. Sure the super form costs a little more, but in the long run statistical certainty is worth the initial outlay.
I understand what you're saying.... but I still don't get why all the hype for the leucy.
Like stated above, it is an end all to morphs. There aren't any combinations (other than the polar ball) that are known to exist. So other than the fact that they produce 100% Butters, Vin Russos, Fires, Mojaves, Yellowbellys, Lessers, etc the Homozygous form doesn't provide an outreach to more designer morphs.
I own a Yellowbelly and want to breed it to produce an Ivory, for the fact of having an all white snake, but not for furthering the morph collection capabilities.
1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown
-
-
Re: leucistic combos
Actually the lucy form would be perfect for combos.. as long as it's one parent, and not two. If a lesser/lesser lucy was used as one parent.. then all offspring would be lesser + other parent, so it makes it easier to make designer combos, very useful
But I think you mean making something that is lucy + other.. which would be neat genetically.. but visually it's liable to be another all white snake, instead of something new and cool looking.
Theresa Baker
No Legs and More
Florida, USA
"Stop being a wimpy monkey,; bare some teeth, steal some food and fling poo with the alphas. "
-
-
BPnet Veteran
Re: leucistic combos
See what i'm curious about is, what have people tried? Has anyone done a pied lucy? A pin lucy? anything other than albino. I mean maybe you'd get a pied with a white head or something?
-
-
Re: leucistic combos
RDR made a lesser pied which was (to paraphrase him) the whitest snake ever. I can not imagine that a BluEL/pied would be anything different in that regard.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
Registered User
Re: leucistic combos
 Originally Posted by asplundii
RDR made a lesser pied which was (to paraphrase him) the whitest snake ever. I can not imagine that a BluEL/pied would be anything different in that regard.
yeah.. Same thing
Last edited by Stewart_Reptiles; 04-08-2009 at 12:25 PM.
-
-
BPnet Veteran
Re: leucistic combos
 Originally Posted by t-Roy
This is from out of no where but it is related to the topic.
Leucistic is the end of any combo right? I mean after a snake is all white, what else can you do? If anything else, it wouldn't be a Leucistic. Know what I mean? Like you cant recognize a pied Leucy, and you can't add no color/patterns to a Leucy because that would defeat the purpose of it being a Leucy, and the Leucy gene wouldn't let that happen anyway..
So Leucy is the end of the morph to me, and please correct me if proven otherwise.
What about the Energy Ball produced by Serpents Den.
It appears to be a type of Lucy with a pattern showing through faintly.
Though has anyone heard what went into making it yet?
-
-
Re: leucistic combos
Has anyone made any combos with super mojaves? I'd imagine that the purple would be enough to display a 2nd color mutation. Same thing for an ivory. Hasn't the pastel ivory been done? That would be just one more reason for me to like super mojos over the other lucies.
-
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|