Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 799

1 members and 798 guests
Most users ever online was 9,191, 03-09-2025 at 12:17 PM.

» Today's Birthdays

None

» Stats

Members: 75,886
Threads: 249,086
Posts: 2,572,036
Top Poster: JLC (31,651)
Welcome to our newest member, fakepath1997
Page 2 of 3 FirstFirst 123 LastLast
Results 11 to 20 of 23
  1. #11
    BPnet Veteran Fearless's Avatar
    Join Date
    09-18-2006
    Location
    Sterling, CO
    Posts
    505
    Thanks
    67
    Thanked 51 Times in 48 Posts
    Images: 55

    Re: leucistic combos

    Quote Originally Posted by Bill Buchman View Post
    From what I understand, Black Eyed Leucy's and Blue Eyed will not make a white snake -- both base morphs will present. Fire Butter, Butter Yellow Belly, Fire Yellow Belly etc.
    But what he was saying is that the mojave and butter would combine to make a blue eyed lucy and then it carrying the pastel and yellowbelly part would just be an extra plus to the pairing.

  2. The Following User Says Thank You to Fearless For This Useful Post:

    Bill Buchman (04-07-2009)

  3. #12
    BPnet Veteran Bill Buchman's Avatar
    Join Date
    12-30-2007
    Location
    So Cal
    Posts
    957
    Thanks
    324
    Thanked 287 Times in 206 Posts
    Images: 80

    Re: leucistic combos

    Quote Originally Posted by Fearless View Post
    But what he was saying is that the mojave and butter would combine to make a blue eyed lucy and then it carrying the pastel and yellowbelly part would just be an extra plus to the pairing.
    If you hit the the odds on the BEL AND the Yellow Belly gene were also present as a third -- it would not be a "visual Leucy" (white snake only) IMHO.
    Bill Buchman

  4. #13
    BPnet Veteran ctrlfreq's Avatar
    Join Date
    07-21-2006
    Location
    Plano, TX
    Posts
    575
    Thanks
    3
    Thanked 44 Times in 31 Posts

    Re: leucistic combos

    Quote Originally Posted by t-Roy View Post
    Leucistic is the end of any combo right? I mean after a snake is all white, what else can you do?
    Leucistics, especially considering to date the fact they're all super forms of co-doms, are more valuable for their breeding potential (ability to throw 100% carrier offspring) than for their potential for more complex Leucistic morphs. Sure the super form costs a little more, but in the long run statistical certainty is worth the initial outlay.

    The Earth is the cradle of mankind, but one cannot live in the cradle forever. -Konstantin Tsiolkovsky




  5. #14
    BPnet Veteran Turbo Serpent's Avatar
    Join Date
    03-18-2009
    Location
    Silverdale, WA
    Posts
    1,841
    Thanks
    535
    Thanked 476 Times in 377 Posts
    Images: 1

    Re: leucistic combos

    Quote Originally Posted by ctrlfreq View Post
    Leucistics, especially considering to date the fact they're all super forms of co-doms, are more valuable for their breeding potential (ability to throw 100% carrier offspring) than for their potential for more complex Leucistic morphs. Sure the super form costs a little more, but in the long run statistical certainty is worth the initial outlay.
    I understand what you're saying.... but I still don't get why all the hype for the leucy.

    Like stated above, it is an end all to morphs. There aren't any combinations (other than the polar ball) that are known to exist. So other than the fact that they produce 100% Butters, Vin Russos, Fires, Mojaves, Yellowbellys, Lessers, etc the Homozygous form doesn't provide an outreach to more designer morphs.

    I own a Yellowbelly and want to breed it to produce an Ivory, for the fact of having an all white snake, but not for furthering the morph collection capabilities.
    1.0: Honey Bee | Lesser | Banana Pastel Enchi | Clown 66% Het Albino
    0.1: Kingpin | x2 Mojave | Super Pastel HGW | Albino | Sterling Mojave Pinstripe | GHI Pewter | Pastel Het Clown | Sable 66% Het Clown

  6. #15
    BPnet Lifer wolfy-hound's Avatar
    Join Date
    10-10-2005
    Location
    Florida
    Posts
    5,505
    Thanks
    2,128
    Thanked 2,221 Times in 1,151 Posts
    Images: 23

    Re: leucistic combos

    Actually the lucy form would be perfect for combos.. as long as it's one parent, and not two. If a lesser/lesser lucy was used as one parent.. then all offspring would be lesser + other parent, so it makes it easier to make designer combos, very useful

    But I think you mean making something that is lucy + other.. which would be neat genetically.. but visually it's liable to be another all white snake, instead of something new and cool looking.
    Theresa Baker
    No Legs and More
    Florida, USA
    "Stop being a wimpy monkey,; bare some teeth, steal some food and fling poo with the alphas. "

  7. #16
    BPnet Veteran
    Join Date
    02-10-2009
    Posts
    263
    Thanks
    22
    Thanked 33 Times in 25 Posts

    Re: leucistic combos

    See what i'm curious about is, what have people tried? Has anyone done a pied lucy? A pin lucy? anything other than albino. I mean maybe you'd get a pied with a white head or something?

  8. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: leucistic combos

    RDR made a lesser pied which was (to paraphrase him) the whitest snake ever. I can not imagine that a BluEL/pied would be anything different in that regard.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  9. #18
    Registered User t-Roy's Avatar
    Join Date
    01-25-2009
    Posts
    166
    Thanks
    21
    Thanked 6 Times in 6 Posts

    Re: leucistic combos

    Quote Originally Posted by asplundii View Post
    RDR made a lesser pied which was (to paraphrase him) the whitest snake ever. I can not imagine that a BluEL/pied would be anything different in that regard.
    yeah.. Same thing
    Last edited by Stewart_Reptiles; 04-08-2009 at 12:25 PM.

  10. #19
    BPnet Veteran JAMills's Avatar
    Join Date
    01-08-2008
    Location
    Brick, NJ
    Posts
    765
    Thanks
    67
    Thanked 136 Times in 108 Posts
    Images: 5

    Re: leucistic combos

    Quote Originally Posted by t-Roy View Post
    This is from out of no where but it is related to the topic.

    Leucistic is the end of any combo right? I mean after a snake is all white, what else can you do? If anything else, it wouldn't be a Leucistic. Know what I mean? Like you cant recognize a pied Leucy, and you can't add no color/patterns to a Leucy because that would defeat the purpose of it being a Leucy, and the Leucy gene wouldn't let that happen anyway..

    So Leucy is the end of the morph to me, and please correct me if proven otherwise.
    What about the Energy Ball produced by Serpents Den.
    It appears to be a type of Lucy with a pattern showing through faintly.
    Though has anyone heard what went into making it yet?

  11. #20
    BPnet Veteran PythonWallace's Avatar
    Join Date
    02-26-2007
    Location
    Woodridge, IL
    Posts
    2,967
    Thanks
    204
    Thanked 346 Times in 210 Posts
    Images: 23

    Re: leucistic combos

    Has anyone made any combos with super mojaves? I'd imagine that the purple would be enough to display a 2nd color mutation. Same thing for an ivory. Hasn't the pastel ivory been done? That would be just one more reason for me to like super mojos over the other lucies.
    What are these mojavas I keep hearing so much about?

    J. W. Exotics

    Reptile Incubators

Page 2 of 3 FirstFirst 123 LastLast

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1