Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 624

1 members and 623 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,912
Threads: 249,118
Posts: 2,572,194
Top Poster: JLC (31,651)
Welcome to our newest member, coda
Results 1 to 10 of 26

Threaded View

  1. #17
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Has anyone crossed these yet?

    Quote Originally Posted by Watever View Post
    Ok, but since albinism is recessive, wouldn't you need both chromosome to be T- ?

    The 15 from the ball, and the other 15 from the burm ? or the 7 from the ball and the 7 from the burm ? otherwise it would be het albino on loci 15 and on loci 7.
    Well you would need both chromosomes, simply as a matter of pairing and the animal being 2n. But the genes on the ball 15 need not necessarily be identical to the genes on the burm 15. As in this example. So, while ball tyr may occupy position XYZ on ball 15 That same position on burm 15 would hold an aminoacyltransferase...

    Or you think that an animal with one T- on the 15 and one T- on the 7 wouldn't present melamine?
    In this example it would have to be that way. The hybrid animal would have no way to "acquire" a wild type gene at the corresponding locus on the chromosome of the non-species parent. Basically what you would have is a animal that is homozygous for T- but heterozygous at each locus.

    BUt as I said, this example is just an off the cuff extreme. If I had to bet odds I would guess that both ball and burm carry their tyr on the same chromosome and at roughly the same position.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    Watever (04-05-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1