» Site Navigation
0 members and 1,894 guests
No Members online
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.
» Today's Birthdays
» Stats
Members: 76,073
Threads: 249,220
Posts: 2,572,813
Top Poster: JLC (31,651)
|
-
Re: Has anyone crossed these yet?
 Originally Posted by Watever
Well, first, I am sorry if you don't understand. My first language is french and not english, when I typed it yesterday it was late and it was just after a long day at work and university and watching a hockey game (with some beers).
No need to apologize, I just wanted to make sure I was not missing something, which it seems I was.
I was trying to say that a albinism gene (T-) can differ from one species to another.
That geneticly they doesn't look the same (chromosome) but their effect are the same on the animal (not produce melamine).
A bit like the Cold virus (I know it's not a gene but it can help you understand what I am trying to say). There is a lot of variation of it, but the effect of it is the same.
The T- in the tiger/alligator/ball/burmese all have the same effect, keep the skin from producing melamine, but I am pretty sure if we were able to look at them under a microscopre, they wouldn't look the same and probably wouldn't been on the same loci.
Making the cross between both species (both showing albinism) not being albinos but het or double het.
Okay, I understand what you are getting at now 
While what you are saying is accurate in a sense it is also incorrect in another sense.
Please allow me to explain.
Ignore for a moment what organism we are talking about. Think only at the level of the enzyme itself.
Tyrosinase, as an enzyme, catalyzes the production of melanin (or other pigments) from tyrosine by way of oxidation.
There are many different structures for tyrosinase enzymes but, in the end, they all do the same thing no matter how different they look from one another.
Now, consider a table top reaction. You have 4 test tubes (call them 1-4), all containing a clear liquid with the necessary bio-reagents to create melanin. All you need is to add a tyrosinase to start the reaction. You also have 2 tubes (A and B), one containing tyrosinase from organism A the other containing tyrosinase from organism B. To tube 1 you add 2 drops of tyrosinase only from tube A the reaction turns brown. To tube 2 you add 2 drops of tyrosinase from only tube B the reaction turns brown. To tube 3 you add one drop from tube A and one drop from tube B and the reaction turns brown. You add nothing to tube 4, that reaction stays clear.
The reason tube 4 stays clear is because there is no tyrosinase to get the reaction going.
Now let us go back to the hybrid snake in question.
The hybrid animal will have one copy of genes from each of its parents. So a wild type ball bred to a wild type burm will generate a hybrid with wild type tyrosinase A from the ball and wild type tyrosinase B from the burm, giving it 2 functional copies of tyrosinase even if both of them are structurally different. This is equivalent to tube 3 in the above experiment.
Change the equation up now using T- albinos as parents. Neither parent has a functional copy of tyrosinase to pass on. So each offspring would get a non-functional A and a non-functional B. With no functional form of tyrosinase the hybrid animal can not catalyze the reaction and will therefore not generate any pigment. This is equivalent to tube 4 in the above experiment.
Make sense?
Also, just a tangent but I would be willing to guess that the tyrosinase in balls and burms is almost identical both structurally and on the DNA level. If you compare the tyrosinase of a human to that of a mouse the proteins are 84% identical. And a ball and a burm are much more closely related than a human and a mouse. 
Cheers
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
-
BPnet Veteran
Re: Has anyone crossed these yet?
For anyone who couldn't see that link to the albino burmball here it is. I think thats really awesome they have produced one.
-
The Following User Says Thank You to PythonBreeder For This Useful Post:
-
BPnet Veteran
Re: Has anyone crossed these yet?
Thank you for your explanation ! It's really good 
 Originally Posted by asplundii
Now, consider a table top reaction. You have 4 test tubes (call them 1-4), all containing a clear liquid with the necessary bio-reagents to create melanin. All you need is to add a tyrosinase to start the reaction.
You are right, in the case of an albino, you only need 1 of the gene to create it. If we have to see it the other way around . I was probably thinking too global.
 Originally Posted by asplundii
Change the equation up now using T- albinos as parents. Neither parent has a functional copy of tyrosinase to pass on. So each offspring would get a non-functional A and a non-functional B. With no functional form of tyrosinase the hybrid animal can not catalyze the reaction and will therefore not generate any pigment. This is equivalent to tube 4 in the above experiment.
I agree on this. But if the T- gene are not on the same loci for both species, wouldn't that mean that both parent would pass a T+ gene and a T- gene ? So if I refer to what you said before, because there is at least 1 T+ gene, the animal wouldn't be albino.
But if both T- gene, on both species, are on the same loci, then it does work 
 Originally Posted by asplundii
Also, just a tangent but I would be willing to guess that the tyrosinase in balls and burms is almost identical both structurally and on the DNA level. If you compare the tyrosinase of a human to that of a mouse the proteins are 84% identical. And a ball and a burm are much more closely related than a human and a mouse.
Cheers
I also believe that. And the picture above prove it (if it's really an hybrid and not a deformed burm).
-
-
Re: Has anyone crossed these yet?
 Originally Posted by Watever
Thank you for your explanation ! It's really good 
IDK about good, it was just the best I could come up with quick LOL. But thanks 
I agree on this. But if the T- gene are not on the same loci for both species, wouldn't that mean that both parent would pass a T+ gene and a T- gene ? So if I refer to what you said before, because there is at least 1 T+ gene, the animal wouldn't be albino.
But if both T- gene, on both species, are on the same loci, then it does work
It works even if the tyr gene is on separate loci for each snake. I was trying to be clear on that but I must have muddied it. Let me try it like this. (And for the record, this is all speculative, I do not know how many chromosomes either species has nor do I know where each has their tyr gene located...)
Each species only has on locus for tyr. Say the ball tyr gene is on chromosome 15 and the burm tyr is on chromosome 7.
Chromosomes come in pairs, one half from the mother and one half from the father. So a ball will have 2 copies of tyr, one for each chromosome 15. And for the burm 2 copies of tyr, one each for chromosome 7.
Now, for the hybrid animal it will still have 2 copies of tyr but one will be on the paternally donated ball python chromosome 15 while the other will be on the maternally donated chromosome 7. And each of these chromosomes would then pair up with the chromosome from the hybrid parent (ball 15 pairs with burm 15 and ball 7 pairs with burm 7) so there are only the 2 copies of tyr in the hybrid animal. Just in two separate locations.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
-
BPnet Veteran
Re: Has anyone crossed these yet?
Ok, but since albinism is recessive, wouldn't you need both chromosome to be T- ?
The 15 from the ball, and the other 15 from the burm ? or the 7 from the ball and the 7 from the burm ? otherwise it would be het albino on loci 15 and on loci 7.
Or you think that an animal with one T- on the 15 and one T- on the 7 wouldn't present melamine ?
-
-
Re: Has anyone crossed these yet?
 Originally Posted by Watever
Ok, but since albinism is recessive, wouldn't you need both chromosome to be T- ?
The 15 from the ball, and the other 15 from the burm ? or the 7 from the ball and the 7 from the burm ? otherwise it would be het albino on loci 15 and on loci 7.
Well you would need both chromosomes, simply as a matter of pairing and the animal being 2n. But the genes on the ball 15 need not necessarily be identical to the genes on the burm 15. As in this example. So, while ball tyr may occupy position XYZ on ball 15 That same position on burm 15 would hold an aminoacyltransferase...
Or you think that an animal with one T- on the 15 and one T- on the 7 wouldn't present melamine?
In this example it would have to be that way. The hybrid animal would have no way to "acquire" a wild type gene at the corresponding locus on the chromosome of the non-species parent. Basically what you would have is a animal that is homozygous for T- but heterozygous at each locus.
BUt as I said, this example is just an off the cuff extreme. If I had to bet odds I would guess that both ball and burm carry their tyr on the same chromosome and at roughly the same position.
actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat
-
The Following User Says Thank You to asplundii For This Useful Post:
Posting Permissions
- You may not post new threads
- You may not post replies
- You may not post attachments
- You may not edit your posts
-
Forum Rules
|