Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 711

1 members and 710 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,945
Threads: 249,140
Posts: 2,572,329
Top Poster: JLC (31,651)
Welcome to our newest member, SONOMANOODLES
Results 1 to 10 of 22

Thread: 2 hets do what?

Threaded View

  1. #2
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: 2 hets do what?

    Well snakes do not "turn in to" anything

    If I am reading you correct you are asking what the progeny of a het x het breeding would be (assuming the animals are both het for the same trait.)

    So to make it easy I will just use albino.

    het albino x het albino will give rise to:

    albino (1:4 odds)
    het albino (1:2 odds)
    normal (1:4 odds)

    The hets and the normals will look the same though, so any given normal looking baby from the litter grabbed at random will have a 1:3 chance of being a het.

    And yes, line breeding is common
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    ParmleyStyle (03-06-2009)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1