Vote for BP.Net for the 2013 Forum of the Year! Click here for more info.

» Site Navigation

» Home
 > FAQ

» Online Users: 933

1 members and 932 guests
Most users ever online was 47,180, 07-16-2025 at 05:30 PM.

» Today's Birthdays

None

» Stats

Members: 75,937
Threads: 249,130
Posts: 2,572,295
Top Poster: JLC (31,651)
Welcome to our newest member, GeorgiaD182
Results 1 to 10 of 34

Thread: Spider breeding

Threaded View

  1. #11
    BPnet Veteran
    Join Date
    10-17-2008
    Posts
    906
    Thanks
    103
    Thanked 722 Times in 382 Posts

    Re: Super spider

    Quote Originally Posted by Bcycling View Post
    Now I may pair the spider x spider/banana. I know the odds are probably like 1 in a trillion, but let's just say this weird looking spider pops out, survives, and is proved to be a super. What would the value on an animal like that even be. Seems to me it would be more of getting your name as the first to successfully produce one that really any money due to the fact that spiders really are a low $ animal. Do u think this is correct thinking?
    There have been a number of people who have already hatched SuperSpiders out, all of which have died. There is neither money nor fame to be gained from it.
    actagggcagtgatatcctagcattgatggtacatggcaaattaacctcatgat

  2. The Following User Says Thank You to asplundii For This Useful Post:

    JodanOrNoDan (06-19-2017)

Posting Permissions

  • You may not post new threads
  • You may not post replies
  • You may not post attachments
  • You may not edit your posts
  •  
Powered by vBadvanced CMPS v4.2.1